National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 6889R-1 
 Symbol tara  Full Name taranis 
 CG No CG6889  Old CG No CG6889 
 Synonyms CG6889, l(3)jlC5, EP(3)3463, l(3)03881, 5472, l(3)j1C5, anon-WO0257455.25, tara 
 Accession No (Link to NCBI) NM_080255.2 
 Inserted Chr. ll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
[Please submit your publication]
Afonso DJ, Liu D, Machado DR, Pan H, Jepson JE, Rogulja D, Koh K.
TARANIS Functions with Cyclin A and Cdk1 in a Novel Arousal Center to Control Sleep in Drosophila.
Curr. Biol. (2015) 25(13) 1717-26 [ PubMed ID = 26096977 ] [ RRC reference ]  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
 Primer Seq. 3'
 Predicted Fragment Size
 IR fragment full Seq
 in silico PCR Fragment
 Assemble Data

                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico      1   AATTCCGCGATGGGTCTTCAAGCAACAGCCGCCACCAAGCGGAAGCATGAGCTGACCTT 59

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     61  CGACAGCAAGGATGCCAACACCACCTACACGGGCAACTGTGCCCCGCCCCCCGTCAAGGC 119

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     121 CAACAAGTGGGCCATCAGCAACAACAACTACCTGGAGTCGCTCGAGGAGCAGCAGCAGCA 179

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     181 ACAGCAATCGCCATCGGAGCCAGCTGTTGAGTCCAACAACAACCACATTGTTTTAGAAGC 239

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     241 ATCAATGGATGCGTTGAAGCCAACGGAGCCAAGTATTAGCAATGGTCATGAAGTTACTAC 299

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     301 CGCCGTCGCAGCAATGAAAAGTCAAGCGGAGGTGCCACTCCCGCCAACAGCGAGTGCGGC 359

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     361 GATACCGGAGGACAGTATCGCCAGGTTAGAGGTGGTCACCTCAGCCGTTCCTTGTGAGCC 419

                          ||||||||||||||||||||||||||| |||||| ||||||||||| ||| |||||||| silico     421 CTGGACGAGCAATGGGCCCACTACTCC-TTCCGC-GGTGGCAGGAC-CCG-CAGCATCCG 479

6889R-1.IR_full       481 CGGAACCTGTGGATTGCATCTCCA 503
                          |||||||||||||||||||||||| silico     481 CGGAACCTGTGGATTGCATCTCCA 503

 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  14  70  NM_080255.2  CG6889-RA, transcript variant A (tara), mRNA 
100   482  14  70  NM_169709.1  CG6889-RB, transcript variant B (tara), mRNA 
1.45   26  91  187  NM_132288.1  CG15365-RA (CG15365), mRNA 
1.24   111  348  709  NM_080536.2  CG4013-RA, transcript variant A (Smr), mRNA 
1.24   111  348  709  NM_167334.1  CG4013-RB, transcript variant B (Smr), mRNA 
1.24   111  348  709  NM_167335.1  CG4013-RC, transcript variant C (Smr), mRNA 
1.24   14  49  135  NM_169025.1  CG2534-RB, transcript variant B (cno), mRNA 
1.24   14  49  135  NM_079508.2  CG2534-RA, transcript variant A (cno), mRNA 
1.24   12  53  127  NM_132525.1  CG15740-RA (CG15740), mRNA 
1.24   14  43  NM_137194.1  CG8179-RA (CG8179), mRNA 
1.03   27  114  320  NM_001038734.1  CG16902-RC (Hr4), mRNA 
0.82   29  92  210  NM_079903.2  CG15319-RB (nej), mRNA 
0.82   28  99  203  NM_169783.1  CG31243-RB, transcript variant B (cpo), mRNA 
0.82   28  99  203  NM_169781.1  CG31243-RE, transcript variant E (cpo), mRNA 
0.82   28  99  203  NM_169782.1  CG31243-RA, transcript variant A (cpo), mRNA 
0.82   23  60  101  NM_001038965.1  CG9924-RE, transcript variant E (CG9924), mRNA 
0.82   19  50  145  NM_079996.2  CG18024-RA (SoxN), mRNA 
0.82   18  71  175  NM_169386.1  CG17228-RA, transcript variant A (pros), mRNA 
0.82   18  67  157  NM_057496.3  CG5058-RC, transcript variant C (grh), mRNA 
0.82   18  67  157  NM_057497.3  CG5058-RD, transcript variant D (grh), mRNA 
0.82   15  57  160  NM_057771.2  CG1864-RB, transcript variant B (Hr38), mRNA 
0.82   10  12  32  NM_143802.2  CG8013-RA, transcript variant A (Su(z)12), mRNA 
0.82   10  12  32  NM_168826.1  CG8013-RB, transcript variant B (Su(z)12), mRNA 
0.82   21  54  NM_165017.1  CG12287-RB, transcript variant B (pdm2), mRNA 
0.82   26  59  NM_142755.1  CG5732-RA (CG5732), mRNA 
0.82   18  84  NM_170027.2  CG31158-RA, transcript variant A (CG31158), mRNA 
0.82   18  84  NM_176541.1  CG31158-RB, transcript variant B (CG31158), mRNA 
0.82   38  66  NM_176312.2  CG33205-RA, transcript variant A (CG33205), mRNA 
0.82   38  66  NM_176308.2  CG33205-RB, transcript variant B (CG33205), mRNA 
0.82   38  66  NM_176309.2  CG33205-RC, transcript variant C (CG33205), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.