National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock temporarily unavailable request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 6889R-1 
 Symbol tara  Full Name taranis 
 CG No CG6889  Old CG No CG6889 
 Synonyms CG6889, l(3)jlC5, EP(3)3463, l(3)03881, 5472, l(3)j1C5, anon-WO0257455.25, tara 
 Accession No (Link to NCBI) NM_080255.2 
 Inserted Chr. ll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
 Reference
[Please submit your publication]
Afonso DJ, Liu D, Machado DR, Pan H, Jepson JE, Rogulja D, Koh K.
TARANIS Functions with Cyclin A and Cdk1 in a Novel Arousal Center to Control Sleep in Drosophila.
Curr. Biol. (2015) 25(13) 1717-26 [ PubMed ID = 26096977 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgGAATTCCGCGATGGGTCTTCA 
 Primer Seq. 3'
aatctagaggtaccTGGAGATGCAATCCACAGGTT 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 NAATTCCGCG ATGGGTCTTC AAGCAACAGC CGCCACCAAG CgGAAGcATG AGCTGACCTT 
0061 CGACAGCAAG GATGCCAACA CCACCTACAC GGGCAACTGT GcCCCGCCCC CCGTCAAgGC 
0121 CAACAAGTGG GCCATCAGCA ACAACAACTA CCTGGAGTCG CTCGAGGAgC AGCAGCAGCA 
0181 ACAGCAATCG CCATCGGAGC CAGCTGTTGA GTCCAACAAC AACCACATTG TTTTAGAAGC 
0241 ATCAATGGAT GCGTTGAAGC CAACGGAGCC AAGTATTAGC AATGGTCATG AAGTTACTAC 
0301 CGCCGTCGCA GCAATGAAAA GTCAAGCGGA GGTGCCACTC CCGCCAACAG CGAGTGCGGC 
0361 GATACCGGAG GACAGTATCG CCAGGTTAGA GGTGGTCACC TCAGCCGTTC CTTGTGAGCC 
0421 CTGGACGAGC AATGGGCCCA CTACTCCATT CCGCNGGTGG CAGGACTCCG CCAGCATccN 
0481 CGGAACCTGT GGATTGCATC TCCA 
 in silico PCR Fragment
0001 GAATTCCGCG ATGGGTCTTC AAGCAACAGC CGCCACCAAG CGGAAGCATG AGCTGACCTT 
0061 CGACAGCAAG GATGCCAACA CCACCTACAC GGGCAACTGT GCCCCGCCCC CCGTCAAGGC 
0121 CAACAAGTGG GCCATCAGCA ACAACAACTA CCTGGAGTCG CTCGAGGAGC AGCAGCAGCA 
0181 ACAGCAATCG CCATCGGAGC CAGCTGTTGA GTCCAACAAC AACCACATTG TTTTAGAAGC 
0241 ATCAATGGAT GCGTTGAAGC CAACGGAGCC AAGTATTAGC AATGGTCATG AAGTTACTAC 
0301 CGCCGTCGCA GCAATGAAAA GTCAAGCGGA GGTGCCACTC CCGCCAACAG CGAGTGCGGC 
0361 GATACCGGAG GACAGTATCG CCAGGTTAGA GGTGGTCACC TCAGCCGTTC CTTGTGAGCC 
0421 CTGGACGAGC AATGGGCCCA CTACTCC-TT CCGC-GGTGG CAGGAC-CCG -CAGCATCCG 
0481 CGGAACCTGT GGATTGCATC TCCA 
 Assemble Data

6889R-1.IR_full        1   AATTCCGCGATGGGTCTTCAAGCAACAGCCGCCACCAAGCGGAAGCATGAGCTGACCTT 59
                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
6889R-1.in silico      1   AATTCCGCGATGGGTCTTCAAGCAACAGCCGCCACCAAGCGGAAGCATGAGCTGACCTT 59


6889R-1.IR_full       61  CGACAGCAAGGATGCCAACACCACCTACACGGGCAACTGTGCCCCGCCCCCCGTCAAGGC 119
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
6889R-1.in silico     61  CGACAGCAAGGATGCCAACACCACCTACACGGGCAACTGTGCCCCGCCCCCCGTCAAGGC 119


6889R-1.IR_full       121 CAACAAGTGGGCCATCAGCAACAACAACTACCTGGAGTCGCTCGAGGAGCAGCAGCAGCA 179
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
6889R-1.in silico     121 CAACAAGTGGGCCATCAGCAACAACAACTACCTGGAGTCGCTCGAGGAGCAGCAGCAGCA 179


6889R-1.IR_full       181 ACAGCAATCGCCATCGGAGCCAGCTGTTGAGTCCAACAACAACCACATTGTTTTAGAAGC 239
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
6889R-1.in silico     181 ACAGCAATCGCCATCGGAGCCAGCTGTTGAGTCCAACAACAACCACATTGTTTTAGAAGC 239


6889R-1.IR_full       241 ATCAATGGATGCGTTGAAGCCAACGGAGCCAAGTATTAGCAATGGTCATGAAGTTACTAC 299
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
6889R-1.in silico     241 ATCAATGGATGCGTTGAAGCCAACGGAGCCAAGTATTAGCAATGGTCATGAAGTTACTAC 299


6889R-1.IR_full       301 CGCCGTCGCAGCAATGAAAAGTCAAGCGGAGGTGCCACTCCCGCCAACAGCGAGTGCGGC 359
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
6889R-1.in silico     301 CGCCGTCGCAGCAATGAAAAGTCAAGCGGAGGTGCCACTCCCGCCAACAGCGAGTGCGGC 359


6889R-1.IR_full       361 GATACCGGAGGACAGTATCGCCAGGTTAGAGGTGGTCACCTCAGCCGTTCCTTGTGAGCC 419
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
6889R-1.in silico     361 GATACCGGAGGACAGTATCGCCAGGTTAGAGGTGGTCACCTCAGCCGTTCCTTGTGAGCC 419


6889R-1.IR_full       421 CTGGACGAGCAATGGGCCCACTACTCCATTCCGCNGGTGGCAGGACTCCGCCAGCATCCN 479
                          ||||||||||||||||||||||||||| |||||| ||||||||||| ||| |||||||| 
6889R-1.in silico     421 CTGGACGAGCAATGGGCCCACTACTCC-TTCCGC-GGTGGCAGGAC-CCG-CAGCATCCG 479


6889R-1.IR_full       481 CGGAACCTGTGGATTGCATCTCCA 503
                          ||||||||||||||||||||||||
6889R-1.in silico     481 CGGAACCTGTGGATTGCATCTCCA 503

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  14  70  NM_080255.2  CG6889-RA, transcript variant A (tara), mRNA 
100   482  14  70  NM_169709.1  CG6889-RB, transcript variant B (tara), mRNA 
1.45   26  91  187  NM_132288.1  CG15365-RA (CG15365), mRNA 
1.24   111  348  709  NM_080536.2  CG4013-RA, transcript variant A (Smr), mRNA 
1.24   111  348  709  NM_167334.1  CG4013-RB, transcript variant B (Smr), mRNA 
1.24   111  348  709  NM_167335.1  CG4013-RC, transcript variant C (Smr), mRNA 
1.24   14  49  135  NM_169025.1  CG2534-RB, transcript variant B (cno), mRNA 
1.24   14  49  135  NM_079508.2  CG2534-RA, transcript variant A (cno), mRNA 
1.24   12  53  127  NM_132525.1  CG15740-RA (CG15740), mRNA 
1.24   14  43  NM_137194.1  CG8179-RA (CG8179), mRNA 
1.03   27  114  320  NM_001038734.1  CG16902-RC (Hr4), mRNA 
0.82   29  92  210  NM_079903.2  CG15319-RB (nej), mRNA 
0.82   28  99  203  NM_169783.1  CG31243-RB, transcript variant B (cpo), mRNA 
0.82   28  99  203  NM_169781.1  CG31243-RE, transcript variant E (cpo), mRNA 
0.82   28  99  203  NM_169782.1  CG31243-RA, transcript variant A (cpo), mRNA 
0.82   23  60  101  NM_001038965.1  CG9924-RE, transcript variant E (CG9924), mRNA 
0.82   19  50  145  NM_079996.2  CG18024-RA (SoxN), mRNA 
0.82   18  71  175  NM_169386.1  CG17228-RA, transcript variant A (pros), mRNA 
0.82   18  67  157  NM_057496.3  CG5058-RC, transcript variant C (grh), mRNA 
0.82   18  67  157  NM_057497.3  CG5058-RD, transcript variant D (grh), mRNA 
0.82   15  57  160  NM_057771.2  CG1864-RB, transcript variant B (Hr38), mRNA 
0.82   10  12  32  NM_143802.2  CG8013-RA, transcript variant A (Su(z)12), mRNA 
0.82   10  12  32  NM_168826.1  CG8013-RB, transcript variant B (Su(z)12), mRNA 
0.82   21  54  NM_165017.1  CG12287-RB, transcript variant B (pdm2), mRNA 
0.82   26  59  NM_142755.1  CG5732-RA (CG5732), mRNA 
0.82   18  84  NM_170027.2  CG31158-RA, transcript variant A (CG31158), mRNA 
0.82   18  84  NM_176541.1  CG31158-RB, transcript variant B (CG31158), mRNA 
0.82   38  66  NM_176312.2  CG33205-RA, transcript variant A (CG33205), mRNA 
0.82   38  66  NM_176308.2  CG33205-RB, transcript variant B (CG33205), mRNA 
0.82   38  66  NM_176309.2  CG33205-RC, transcript variant C (CG33205), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.