National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 6883R-2 
 Symbol trh  Full Name trachealess 
 CG No CG6883  Old CG No CG6883 
 Synonyms TRH, DMU42699, 3.1, l(3)10512, CG6883, trh, CG13885, HDC07747, BP1081, unnamed, trachealess, Trh 
 Accession No (Link to NCBI) NM_079148.2 
 Inserted Chr. ll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
 Reference
[Please submit your publication]
Tajiri R, Tsuji T, Ueda R, Saigo K, Kojima T.
Fate determination of Drosophila leg distal regions by trachealess and tango through repression and stimulation, respectively, of Bar homeobox gene expression in the future pretarsus and tarsus.
Dev. Biol. (2007) 303(2) 461-73 [ PubMed ID = 17187773 ] [ RRC reference ]

Mummery-Widmer JL, Yamazaki M, Stoeger T, Novatchkova M, Bhalerao S, Chen D, Dietzl G, Dickson BJ, Knoblich JA.
Genome-wide analysis of Notch signalling in Drosophila by transgenic RNAi.
Nature (2009) 458(7241) 987-92 [ PubMed ID = 19363474 ] [ RRC reference ]

Nitta Y, Yamazaki D, Sugie A, Hiroi M, Tabata T.
DISCO Interacting Protein 2 regulates axonal bifurcation and guidance of Drosophila mushroom body neurons.
Dev. Biol. (2017) 421(2) 233-244 [ PubMed ID = 27908785 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgGGATACCAGAGACAGCCCACG 
 Primer Seq. 3'
aatctagaggtaccTGGGTGCCCTGATGTTGCTCG 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 GGATACCAGA GACAGCCCAC GCCCGGACAT CCCGGAAGCC ACATGGCCAC CATGGGATCT 
0061 CTGGGCATGC CCGCGGTGCC CTTCACCCAC AGCTGGATGG TGCCCACGCA GGACCTTTGC 
0121 GCCATGCCAC CCTACAACAA AATGACCGGA CACCAGCAGC CGCCAGGTGC CNGGGAATGC 
0181 ACGCCCAGCA ACAGCCCCTC GAGCCCGGCA TCCTGGAGCT GCGCAAGGAG AAGTCGAGGG 
0241 ACGCGGCGAG ANCGCGGCGC GGAAAGGAGA ACTACGAGTT CTACGAGCTA GCCAAGATGC 
0301 TCCCTCTGNC GGCAGCCATC ANCAGCCAGC TGGACAAGGC CTCGATCATA AGACTGACCA 
0361 TCAGCTACCT GAAGCTGAGG GATTTCTCCG GACACgGCGA TCCGCCATGG ACTCGGGAAG 
0421 CCTCTAGCAG CAGTAAGCTA AAAAGTGCCG CCATTCGTCG CAGCCCCGCT GTTGATTTGT 
0481 TCGAGCAACA TCAGGGCACC CA 
 in silico PCR Fragment
0001 GGATACCAGA GACAGCCCAC GCCCGGACAT CCCGGAAGCC ACATGGCCAC CATGGGATCT 
0061 CTGGGCATGC CCGCGGTGCC CTTCACCCAC AGCTGGATGG TGCCCACGCA GGACCTTTGC 
0121 GCCATGCCAC CCTACAACAA AATGACCGGA CACCAGCAGC CGCCAGGTGC C--GGAATGC 
0181 ACGCCCAGCA ACAGCCCCTC GAGCCCGGCA TCCTGGAGCT GCGCAAGGAG AAGTCGAGGG 
0241 ACGCGGCGAG ATCGCGGCGC GGAAAGGAGA ACTACGAGTT CTACGAGCTA GCCAAGATGC 
0301 TCCCTCTGCC GGCAGCCATC ACCAGCCAGC TGGACAAGGC CTCGATCATA AGACTGACCA 
0361 TCAGCTACCT GAAGCTGAGG GATTTCTCCG GACACGGCGA TCCGCCATGG ACTCGGGAAG 
0421 CCTCTAGCAG CAGTAAGCTA AAAAGTGCCG CCATTCGTCG CAGCCCCGCT GTTGATTTGT 
0481 TCGAGCAACA TCAGGGCACC CA 
 Assemble Data

6883R-2.IR_full       1   GGATACCAGAGACAGCCCACGCCCGGACATCCCGGAAGCCACATGGCCACCATGGGATCT 60
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
6883R-2.in silico     1   GGATACCAGAGACAGCCCACGCCCGGACATCCCGGAAGCCACATGGCCACCATGGGATCT 60


6883R-2.IR_full       61  CTGGGCATGCCCGCGGTGCCCTTCACCCACAGCTGGATGGTGCCCACGCAGGACCTTTGC 120
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
6883R-2.in silico     61  CTGGGCATGCCCGCGGTGCCCTTCACCCACAGCTGGATGGTGCCCACGCAGGACCTTTGC 120


6883R-2.IR_full       121 GCCATGCCACCCTACAACAAAATGACCGGACACCAGCAGCCGCCAGGTGCCNGGGAATGC 180
                          |||||||||||||||||||||||||||||||||||||||||||||||||||  |||||||
6883R-2.in silico     121 GCCATGCCACCCTACAACAAAATGACCGGACACCAGCAGCCGCCAGGTGCC--GGAATGC 180


6883R-2.IR_full       181 ACGCCCAGCAACAGCCCCTCGAGCCCGGCATCCTGGAGCTGCGCAAGGAGAAGTCGAGGG 240
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
6883R-2.in silico     181 ACGCCCAGCAACAGCCCCTCGAGCCCGGCATCCTGGAGCTGCGCAAGGAGAAGTCGAGGG 240


6883R-2.IR_full       241 ACGCGGCGAGANCGCGGCGCGGAAAGGAGAACTACGAGTTCTACGAGCTAGCCAAGATGC 300
                          ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||
6883R-2.in silico     241 ACGCGGCGAGATCGCGGCGCGGAAAGGAGAACTACGAGTTCTACGAGCTAGCCAAGATGC 300


6883R-2.IR_full       301 TCCCTCTGNCGGCAGCCATCANCAGCCAGCTGGACAAGGCCTCGATCATAAGACTGACCA 360
                          |||||||| |||||||||||| ||||||||||||||||||||||||||||||||||||||
6883R-2.in silico     301 TCCCTCTGCCGGCAGCCATCACCAGCCAGCTGGACAAGGCCTCGATCATAAGACTGACCA 360


6883R-2.IR_full       361 TCAGCTACCTGAAGCTGAGGGATTTCTCCGGACACGGCGATCCGCCATGGACTCGGGAAG 420
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
6883R-2.in silico     361 TCAGCTACCTGAAGCTGAGGGATTTCTCCGGACACGGCGATCCGCCATGGACTCGGGAAG 420


6883R-2.IR_full       421 CCTCTAGCAGCAGTAAGCTAAAAAGTGCCGCCATTCGTCGCAGCCCCGCTGTTGATTTGT 480
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
6883R-2.in silico     421 CCTCTAGCAGCAGTAAGCTAAAAAGTGCCGCCATTCGTCGCAGCCCCGCTGTTGATTTGT 480


6883R-2.IR_full       481 TCGAGCAACATCAGGGCACCCA 502
                          ||||||||||||||||||||||
6883R-2.in silico     481 TCGAGCAACATCAGGGCACCCA 502

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_001043110.1  CG6883-RB, transcript variant B (trh), mRNA 
100   482  NM_079148.2  CG6883-RA, transcript variant A (trh), mRNA 
0.41   NM_135605.2  CG6729-RA (CG6729), mRNA 
0   NM_143225.2  CG6490-RA (CG6490), mRNA 
0   NM_135839.2  CG7953-RA (CG7953), mRNA 
0   NM_165738.1  CG2269-RC, transcript variant C (CG2269), mRNA 
0   NM_136709.2  CG2269-RA, transcript variant A (CG2269), mRNA 
0   NM_165737.1  CG2269-RB, transcript variant B (CG2269), mRNA 
0   NM_141128.2  CG9063-RA (CG9063), mRNA 
0   NM_169061.1  CG9063-RA (CG9063), mRNA,4,5,-tris-phosphate receptor CG1063-RA, transcript variant A (Itp-r83A), mRNA 
0   NM_169060.1  CG9063-RA (CG9063), mRNA,4,5,-tris-phosphate receptor CG1063-RA, transcript variant A (Itp-r83A), mRNA,4,5,-tris-phosphate receptor CG1063-RB, transcript variant B (Itp-r83A), mRNA 
0   NM_132072.1  CG14446-RA (CG14446), mRNA 
0   NM_078586.3  CG4070-RA, transcript variant A (Tis11), mRNA 
0   NM_167333.2  CG4070-RB, transcript variant B (Tis11), mRNA 
0   NM_141965.1  CG14395-RA (CG14395), mRNA 
0   10  NM_057265.3  CG1264-RA (lab), mRNA 
0   NM_206154.1  CG33130-RB, transcript variant B (l(2)k07433), mRNA 
0   NM_176218.1  CG33130-RA, transcript variant A (l(2)k07433), mRNA 
0   NM_206153.1  CG33130-RC, transcript variant C (l(2)k07433), mRNA 
0   NM_001043282.1  CG4467-RB, transcript variant B (CG4467), mRNA 
0   NM_057597.2  CG10719-RA, transcript variant A (brat), mRNA 
0   NM_134302.1  CG10719-RB, transcript variant B (brat), mRNA 
0   NM_206004.1  CG10719-RC, transcript variant C (brat), mRNA 
0   NR_002032.1  CG10719-RC, transcript variant C (brat), mRNA, miscRNA 
0   NM_136250.2  CG9247-RA (CG9247), mRNA 
0   NM_001043112.1  CG33484-RB, transcript variant B (zormin), mRNA 
0   NM_001043114.1  CG33484-RD, transcript variant D (zormin), mRNA 
0   NM_206240.1  CG33484-RA, transcript variant A (zormin), mRNA 
0   NM_001043113.1  CG33484-RC, transcript variant C (zormin), mRNA 
0   NM_141520.2  CG9630-RA (CG9630), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.