National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock discarded request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 6859R-4 
 Symbol CG6859  Full Name CG6859 
 CG No CG6859  Old CG No CG6859 
 Synonyms CG6859 
 Accession No (Link to NCBI) NM_140496.2 
 Inserted Chr. ll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
 Reference
[Please submit your publication]
Merkling SH, Riahi H, Overheul GJ, Schenck A, van Rij RP.
Peroxisome-associated Sgroppino links fat metabolism with survival after RNA virus infection in Drosophila.
Sci Rep (2019) 9(1) 2065 [ PubMed ID = 30765784 ] [ RRC reference ]

Faust JE, Manisundaram A, Ivanova PT, Milne SB, Summerville JB, Brown HA, Wangler M, Stern M, McNew JA.
Peroxisomes are required for lipid metabolism and muscle function in Drosophila melanogaster.
PLoS One (2014) 9(6) e100213 [ PubMed ID = 24945818 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgACCATCTTTGCGGCACGTTAT 
 Primer Seq. 3'
aatctagaggtaccAGCGGTATGGTCTTGGTGACT 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 ACCATCTTTG CGGCaCGTTA TGCACAACGG CGATTCGTGG AGTTCCAGGA GAAACAGGCC 
0061 AGGGAATTCT TCGAGAGAAC GCGGCgNACG ACCCACTTTG AGTCGACGGA GAAGACGTGT 
0121 AACCAGGTGA TCCTAGGCAT GGGCGAGGAG ATGTGCCAAG CGGTTCTGAG GGAGTGCAGC 
0181 ACGGACGAGC TGCTCGAGCA gCTGCGCCAG AATCCCAAGA ACAAGTTGGA ACTTTGGGAG 
0241 GACATGAAAA TTGTGGCATT CACAAGACTG GCAACCTATG TCTACGCCTC CTCCATGCTG 
0301 GTTATTGCGT TGAGGGTCCA GCTAAATCTT CTCGGTGGCT ACATCTATCG GGACATCATG 
0361 ACGGAACAAA AACAAGTCAC CGACGAGCTA AAGCAGCAGT ATCTCTCCCT CATCCGACAC 
0421 TTTATCACGG ATTCAGGCAT CCGGGACTTA GCCCGTTACA TTCGCACCCA GGTCATCGCA 
0481 GTCACCAAGA CCATACCGCT  
 in silico PCR Fragment
0001 ACCATCTTTG CGGCACGTTA TGCACAACGG CGATTCGTGG AGTTCCAGGA GAAACAGGCC 
0061 AGGGAATTCT TCGAGAGAAC GCGGCGCACG ACCCACTTTG AGTCGACGGA GAAGACGTGT 
0121 AACCAGGTGA TCCTAGGCAT GGGCGAGGAG ATGTGCCAAG CGGTTCTGAG GGAGTGCAGC 
0181 ACGGACGAGC TGCTCGAGCA GCTGCGCCAG AATCCCAAGA ACAAGTTGGA ACTTTGGGAG 
0241 GACATGAAAA TTGTGGCATT CACAAGACTG GCAACCTATG TCTACGCCTC CTCCATGCTG 
0301 GTTATTGCGT TGAGGGTCCA GCTAAATCTT CTCGGTGGCT ACATCTATCG GGACATCATG 
0361 ACGGAACAAA AACAAGTCAC CGACGAGCTA AAGCAGCAGT ATCTCTCCCT CATCCGACAC 
0421 TTTATCACGG ATTCGGGCAT CCGGGACTTA GCCCGTTACA TTCGCACCCA GGTCATCGCA 
0481 GTCACCAAGA CCATACCGCT  
 Assemble Data

6859R-4.IR_full       1   ACCATCTTTGCGGCACGTTATGCACAACGGCGATTCGTGGAGTTCCAGGAGAAACAGGCC 60
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
6859R-4.in silico     1   ACCATCTTTGCGGCACGTTATGCACAACGGCGATTCGTGGAGTTCCAGGAGAAACAGGCC 60


6859R-4.IR_full       61  AGGGAATTCTTCGAGAGAACGCGGCGNACGACCCACTTTGAGTCGACGGAGAAGACGTGT 120
                          |||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||
6859R-4.in silico     61  AGGGAATTCTTCGAGAGAACGCGGCGCACGACCCACTTTGAGTCGACGGAGAAGACGTGT 120


6859R-4.IR_full       121 AACCAGGTGATCCTAGGCATGGGCGAGGAGATGTGCCAAGCGGTTCTGAGGGAGTGCAGC 180
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
6859R-4.in silico     121 AACCAGGTGATCCTAGGCATGGGCGAGGAGATGTGCCAAGCGGTTCTGAGGGAGTGCAGC 180


6859R-4.IR_full       181 ACGGACGAGCTGCTCGAGCAGCTGCGCCAGAATCCCAAGAACAAGTTGGAACTTTGGGAG 240
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
6859R-4.in silico     181 ACGGACGAGCTGCTCGAGCAGCTGCGCCAGAATCCCAAGAACAAGTTGGAACTTTGGGAG 240


6859R-4.IR_full       241 GACATGAAAATTGTGGCATTCACAAGACTGGCAACCTATGTCTACGCCTCCTCCATGCTG 300
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
6859R-4.in silico     241 GACATGAAAATTGTGGCATTCACAAGACTGGCAACCTATGTCTACGCCTCCTCCATGCTG 300


6859R-4.IR_full       301 GTTATTGCGTTGAGGGTCCAGCTAAATCTTCTCGGTGGCTACATCTATCGGGACATCATG 360
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
6859R-4.in silico     301 GTTATTGCGTTGAGGGTCCAGCTAAATCTTCTCGGTGGCTACATCTATCGGGACATCATG 360


6859R-4.IR_full       361 ACGGAACAAAAACAAGTCACCGACGAGCTAAAGCAGCAGTATCTCTCCCTCATCCGACAC 420
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
6859R-4.in silico     361 ACGGAACAAAAACAAGTCACCGACGAGCTAAAGCAGCAGTATCTCTCCCTCATCCGACAC 420


6859R-4.IR_full       421 TTTATCACGGATTCAGGCATCCGGGACTTAGCCCGTTACATTCGCACCCAGGTCATCGCA 480
                          |||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||
6859R-4.in silico     421 TTTATCACGGATTCGGGCATCCGGGACTTAGCCCGTTACATTCGCACCCAGGTCATCGCA 480


6859R-4.IR_full       481 GTCACCAAGACCATACCGCT 500
                          ||||||||||||||||||||
6859R-4.in silico     481 GTCACCAAGACCATACCGCT 500

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_140496.2  CG6859-RA (CG6859), mRNA 
0   NM_141661.1  CG8312-RA, transcript variant A (CG8312), mRNA 
0   NM_176438.1  CG8312-RB, transcript variant B (CG8312), mRNA 
0   NM_167553.1  CG9059-RA, transcript variant A (CG9059), mRNA 
0   NM_132957.1  CG9059-RB, transcript variant B (CG9059), mRNA 
0   NM_176033.1  CG18146-RB, transcript variant B (CG18146), mRNA 
0   NM_135851.2  CG18146-RA, transcript variant A (CG18146), mRNA 
0   NM_139422.2  CG1017-RA (CG1017), mRNA 
0   NM_164843.1  CG9556-RA, transcript variant A (alien), mRNA 
0   NM_078793.4  CG9556-RB, transcript variant B (alien), mRNA 
0   NM_168243.1  CG8114-RD, transcript variant D (pbl), mRNA 
0   NM_168242.1  CG8114-RC, transcript variant C (pbl), mRNA 
0   NM_079241.2  CG8114-RB, transcript variant B (pbl), mRNA 
0   NM_168241.1  CG8114-RA, transcript variant A (pbl), mRNA 
0   NM_140634.1  CG4680-RA (CG4680), mRNA 
0   NM_137693.1  CG30296-RC, transcript variant C (CG30296), mRNA 
0   NM_166418.1  CG30296-RD, transcript variant D (CG30296), mRNA 
0   NM_206188.1  CG30296-RA, transcript variant A (CG30296), mRNA 
0   NM_137139.1  CG12858-RA (CG12858), mRNA 
0   NM_132675.2  CG11177-RA (BthD), mRNA 
0   NM_165444.1  CG8390-RB, transcript variant B (vlc), mRNA 
0   NM_132070.1  CG3599-RA (CG3599), mRNA 
0   NM_001014687.1  CG2165-RE, transcript variant E (CG2165), mRNA 
0   NM_001014689.1  CG2165-RC, transcript variant C (CG2165), mRNA 
0   NM_166754.3  CG2165-RA, transcript variant A (CG2165), mRNA 
0   NM_001014688.1  CG2165-RD, transcript variant D (CG2165), mRNA 
0   NM_166755.3  CG2165-RB, transcript variant B (CG2165), mRNA 
0   NM_166243.1  CG30108-RA (CG30108), mRNA 
0   NM_140889.1  CG14101-RA (CG14101), mRNA 
0   NM_079604.2  CG5266-RA (Pros25), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.