National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 6831R-1 
 Symbol rhea  Full Name rhea 
 CG No CG6831  Old CG No CG6831 
 Synonyms rhea, talin, Talin, CG6831, CT21159, Tln 
 Accession No (Link to NCBI) NM_139981.2 
 Inserted Chr. ll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
[Please submit your publication]
Park SH, Lee CW, Choe KM.
Interplay between integrins and PI4P5K Sktl is crucial for cell polarization and reepithelialisation during Drosophila wound healing.
Sci Rep (2019) 9(1) 16331 [ PubMed ID = 31704968 ] [ RRC reference ]

Xie X, Gilbert M, Petley-Ragan L, Auld VJ.
Loss of focal adhesions in glia disrupts both glial and photoreceptor axon migration in the Drosophila visual system.
Development (2014) 141(15) 3072-83 [ PubMed ID = 25053436 ] [ RRC reference ]

Park SH, Lee CW, Lee JH, Park JY, Roshandell M, Brennan CA, Choe KM.
Requirement for and polarized localization of integrin proteins during Drosophila wound closure.
Mol Biol Cell (2018) 29(18) 2137-2147 [ PubMed ID = 29995573 ] [ RRC reference ]

Perkins AD, Ellis SJ, Asghari P, Shamsian A, Moore ED, Tanentzapf G.
Integrin-mediated adhesion maintains sarcomeric integrity.
Dev Biol (2010) 338(1) 15-27 [ PubMed ID = 19879257 ] [ RRC reference ]

Xie X, Auld VJ.
Integrins are necessary for the development and maintenance of the glial layers in the Drosophila peripheral nerve.
Development (2011) 138(17) 3813-22 [ PubMed ID = 21828098 ] [ RRC reference ]

Yano H, Yamamoto-Hino M, Awano W, Aoki-Kinoshita KF, Tsuda-Sakurai K, Okano H, Goto S.
Identification of proteasome components required for apical localization of Chaoptin using functional genomics.
J Neurogenet (2012) 26(1) 53-63 [ PubMed ID = 22417167 ] [ RRC reference ]  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
 Primer Seq. 3'
 Predicted Fragment Size
 IR fragment full Seq
 in silico PCR Fragment
 Assemble Data

                          |||||||||||||||||||||||||||||||||| ||||| ||||||| ||||||||||| silico     1   CCATACAGTTCCAGCCCAACACCACAGTCTTCGA-TGCCT-GCAAGGT-CATTCGCGATA 60

                          ||||  |||||||| |||||||||||| |||||||||||||||| ||||||||||||||| silico     61  AGTT--CGCCGAGG-CAGTGCAAGGAC-AACCCAGCGAATATGG-ACTGTTTATCTCTGA 120

                           |||| |||||||||||||||||||||||| || |||||||||||||| ||||||||||| silico      121 TGAG-CAGAACCAGCAGGGGGTTTGGTTGGAA-CCGGGACGCACCCT-GGGCTACTACA 179

                          |||||||||| ||||||||||||||||||||||||| |||| |||   |||||||||||| silico     181 TACTGCACAA-CCAGGATACGCTGGAGTATCGCCGC-AAGA-CAC--GAACCCTACGTGT 239

                          ||  |||||||||||||||||||||||||||||||||||||||| ||||||||||||||| silico     241 TCGTATGTTGGATGGCGCTGTAAAGACCATTCTGGTGGATGACT-CCCAGCCGGTGTCGC 299

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     301 AGCTTATGGTGGTCATCTGCACAAAGATCGGCATCACCAATCATGAGGAATATGGATTGG 359

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     361 TGCGCGAGGACAATGAGGCGCAGAATGAGAATCTGCCGGACAACAAGTTTGGAACGCTTA 419

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     421 CCCTTAAGCGTAAGATTATGGAGAAGGATCGCGATGCCAAAATGGAGAGTTTGCGCAAGA 479

                          |||||||||||||||||||||||||||||||||||||| silico     481 AACTAAAGACGGACGATGAAATGAACTGGGTGGATGTG 517

 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_139981.2  CG6831-RA (rhea), mRNA 
0   NM_165878.1  CG30046-RB (CG30046), mRNA 
0   NM_078693.2  CG9565-RA (Nep3), mRNA 
0   NM_141248.2  CG31536-RC, transcript variant C (Cdep), mRNA 
0   NM_001043211.1  CG31536-RE, transcript variant E (Cdep), mRNA 
0   NM_169022.1  CG31536-RA, transcript variant A (Cdep), mRNA 
0   NM_139563.2  CG10359-RA (CG10359), mRNA 
0   NM_142753.2  CG5740-RB, transcript variant B (CG5740), mRNA 
0   NM_169996.1  CG5740-RA, transcript variant A (CG5740), mRNA 
0   NM_135778.1  CG16815-RA (CG16815), mRNA 
0   NM_079119.2  CG4354-RA (slbo), mRNA 
0   NM_135265.1  CG4971-RA (Wnt10), mRNA 
0   NM_135338.1  CG8673-RA (CG8673), mRNA 
0   NM_168357.2  CG32045-RB, transcript variant B (fry), mRNA 
0   NM_001043133.1  CG32045-RD, transcript variant D (fry), mRNA 
0   NM_133073.2  CG6394-RA, transcript variant A (GalNAc-T2), mRNA 
0   NM_167623.1  CG6394-RB, transcript variant B (GalNAc-T2), mRNA 
0   NM_164843.1  CG9556-RA, transcript variant A (alien), mRNA 
0   NM_078793.4  CG9556-RB, transcript variant B (alien), mRNA 
0   NM_080013.2  CG6050-RA (EfTuM), mRNA 
0   14  NM_057685.3  CG11527-RA (Tig), mRNA 
0   NM_057984.3  CG3460-RA (Nmd3), mRNA 
0   NM_135281.1  CG6630-RA (CG6630), mRNA 
0   NM_079913.2  CG8110-RA, transcript variant A (syd), mRNA 
0   NM_168245.2  CG8110-RB, transcript variant B (syd), mRNA 
0   NM_142803.1  CG5326-RA, transcript variant A (CG5326), mRNA 
0   NM_132681.1  CG15760-RA (CG15760), mRNA 
0   NM_137794.2  CG11073-RA (CG11073), mRNA 
0   NM_079455.3  CG12306-RA, transcript variant A (polo), mRNA 
0   NM_143439.2  CG2010-RB, transcript variant B (CG2010), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.