National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 6831R-1 
 Symbol rhea  Full Name rhea 
 CG No CG6831  Old CG No CG6831 
 Synonyms rhea, talin, Talin, CG6831, CT21159, Tln 
 Accession No (Link to NCBI) NM_139981.2 
 Inserted Chr. ll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
 Reference
[Please submit your publication]
Xie X, Gilbert M, Petley-Ragan L, Auld VJ.
Loss of focal adhesions in glia disrupts both glial and photoreceptor axon migration in the Drosophila visual system.
Development (2014) 141(15) 3072-83 [ PubMed ID = 25053436 ] [ RRC reference ]

Yano H, Yamamoto-Hino M, Awano W, Aoki-Kinoshita KF, Tsuda-Sakurai K, Okano H, Goto S.
Identification of proteasome components required for apical localization of Chaoptin using functional genomics.
J Neurogenet. (2012) 26(1) 53-63 [ PubMed ID = 22417167 ] [ RRC reference ]

Perkins AD, Ellis SJ, Asghari P, Shamsian A, Moore ED, Tanentzapf G.
Integrin-mediated adhesion maintains sarcomeric integrity.
Dev. Biol. (2010) 338(1) 15-27 [ PubMed ID = 19879257 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgCCATACAGTTCCAGCCCAACA 
 Primer Seq. 3'
aatctagaggtaccCACATCCACCCAGTTCATTTC 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 CCATACAGTT CCAGCCCAAC ACCACAGTCT TCGANTGCCT NGCAAGGTCC ATTCGCGATA 
0061 AGTTTCCGCC GAGGCCAGTG CAAGGACNAA CCCAGCGAAT ATGGNACTGT TTATCTCTGA 
0121 NTGAGCCAGA ACCAGCAGGG GGTTTGGTTG NAACCCGGGA CGCACCCTGG GGCTACTACA 
0181 TACTGCACAA CCCAGGATAC GCTGGAGTAT CGCCGCAAAG ACCACNNAAA CCCTACGTGT 
0241 TCNCATGTTG GATGGCGCTG TAAAGACCAT TCTGGTGGAT GACTNCCCAG CCGGTGTCGC 
0301 AGCTTATGGT GGTCATCTGC ACAAAGATCG GCATCACCAA TCATGAGGAA TATGGATTGG 
0361 TGCGCGAGGA CAATGAGGCG CAGAATGAGA ATCTGCCGGA CAACAAGTTT GGAACGCTTA 
0421 CCCTTAAGCG TAAGATTATG GAGAAGGATC gCGATGCCAA AATGGAGAGT TTGCGCAAGA 
0481 AACTAAAGAC GGACGATGAA ATGAACTGGG TGGATGTG 
 in silico PCR Fragment
0001 CCATACAGTT CCAGCCCAAC ACCACAGTCT TCGA-TGCCT -GCAAGGT-C ATTCGCGATA 
0061 AGTT--CGCC GAGG-CAGTG CAAGGAC-AA CCCAGCGAAT ATGG-ACTGT TTATCTCTGA 
0121 -TGAG-CAGA ACCAGCAGGG GGTTTGGTTG GAA-CCGGGA CGCACCCT-G GGCTACTACA 
0181 TACTGCACAA -CCAGGATAC GCTGGAGTAT CGCCGC-AAG A-CAC--GAA CCCTACGTGT 
0241 TCGTATGTTG GATGGCGCTG TAAAGACCAT TCTGGTGGAT GACT-CCCAG CCGGTGTCGC 
0301 AGCTTATGGT GGTCATCTGC ACAAAGATCG GCATCACCAA TCATGAGGAA TATGGATTGG 
0361 TGCGCGAGGA CAATGAGGCG CAGAATGAGA ATCTGCCGGA CAACAAGTTT GGAACGCTTA 
0421 CCCTTAAGCG TAAGATTATG GAGAAGGATC GCGATGCCAA AATGGAGAGT TTGCGCAAGA 
0481 AACTAAAGAC GGACGATGAA ATGAACTGGG TGGATGTG 
 Assemble Data

6831R-1.IR_full       1   CCATACAGTTCCAGCCCAACACCACAGTCTTCGANTGCCTNGCAAGGTCCATTCGCGATA 60
                          |||||||||||||||||||||||||||||||||| ||||| ||||||| |||||||||||
6831R-1.in silico     1   CCATACAGTTCCAGCCCAACACCACAGTCTTCGA-TGCCT-GCAAGGT-CATTCGCGATA 60


6831R-1.IR_full       61  AGTTTCCGCCGAGGCCAGTGCAAGGACNAACCCAGCGAATATGGNACTGTTTATCTCTGA 120
                          ||||  |||||||| |||||||||||| |||||||||||||||| |||||||||||||||
6831R-1.in silico     61  AGTT--CGCCGAGG-CAGTGCAAGGAC-AACCCAGCGAATATGG-ACTGTTTATCTCTGA 120


6831R-1.IR_full        121 TGAGCCAGAACCAGCAGGGGGTTTGGTTGNAACCCGGGACGCACCCTGGGGCTACTACA 179
                           |||| |||||||||||||||||||||||| || |||||||||||||| |||||||||||
6831R-1.in silico      121 TGAG-CAGAACCAGCAGGGGGTTTGGTTGGAA-CCGGGACGCACCCT-GGGCTACTACA 179


6831R-1.IR_full       181 TACTGCACAACCCAGGATACGCTGGAGTATCGCCGCAAAGACCACNNAAACCCTACGTGT 239
                          |||||||||| ||||||||||||||||||||||||| |||| |||   ||||||||||||
6831R-1.in silico     181 TACTGCACAA-CCAGGATACGCTGGAGTATCGCCGC-AAGA-CAC--GAACCCTACGTGT 239


6831R-1.IR_full       241 TCNCATGTTGGATGGCGCTGTAAAGACCATTCTGGTGGATGACTNCCCAGCCGGTGTCGC 299
                          ||  |||||||||||||||||||||||||||||||||||||||| |||||||||||||||
6831R-1.in silico     241 TCGTATGTTGGATGGCGCTGTAAAGACCATTCTGGTGGATGACT-CCCAGCCGGTGTCGC 299


6831R-1.IR_full       301 AGCTTATGGTGGTCATCTGCACAAAGATCGGCATCACCAATCATGAGGAATATGGATTGG 359
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
6831R-1.in silico     301 AGCTTATGGTGGTCATCTGCACAAAGATCGGCATCACCAATCATGAGGAATATGGATTGG 359


6831R-1.IR_full       361 TGCGCGAGGACAATGAGGCGCAGAATGAGAATCTGCCGGACAACAAGTTTGGAACGCTTA 419
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
6831R-1.in silico     361 TGCGCGAGGACAATGAGGCGCAGAATGAGAATCTGCCGGACAACAAGTTTGGAACGCTTA 419


6831R-1.IR_full       421 CCCTTAAGCGTAAGATTATGGAGAAGGATCGCGATGCCAAAATGGAGAGTTTGCGCAAGA 479
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
6831R-1.in silico     421 CCCTTAAGCGTAAGATTATGGAGAAGGATCGCGATGCCAAAATGGAGAGTTTGCGCAAGA 479


6831R-1.IR_full       481 AACTAAAGACGGACGATGAAATGAACTGGGTGGATGTG 517
                          ||||||||||||||||||||||||||||||||||||||
6831R-1.in silico     481 AACTAAAGACGGACGATGAAATGAACTGGGTGGATGTG 517

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_139981.2  CG6831-RA (rhea), mRNA 
0   NM_165878.1  CG30046-RB (CG30046), mRNA 
0   NM_078693.2  CG9565-RA (Nep3), mRNA 
0   NM_141248.2  CG31536-RC, transcript variant C (Cdep), mRNA 
0   NM_001043211.1  CG31536-RE, transcript variant E (Cdep), mRNA 
0   NM_169022.1  CG31536-RA, transcript variant A (Cdep), mRNA 
0   NM_139563.2  CG10359-RA (CG10359), mRNA 
0   NM_142753.2  CG5740-RB, transcript variant B (CG5740), mRNA 
0   NM_169996.1  CG5740-RA, transcript variant A (CG5740), mRNA 
0   NM_135778.1  CG16815-RA (CG16815), mRNA 
0   NM_079119.2  CG4354-RA (slbo), mRNA 
0   NM_135265.1  CG4971-RA (Wnt10), mRNA 
0   NM_135338.1  CG8673-RA (CG8673), mRNA 
0   NM_168357.2  CG32045-RB, transcript variant B (fry), mRNA 
0   NM_001043133.1  CG32045-RD, transcript variant D (fry), mRNA 
0   NM_133073.2  CG6394-RA, transcript variant A (GalNAc-T2), mRNA 
0   NM_167623.1  CG6394-RB, transcript variant B (GalNAc-T2), mRNA 
0   NM_164843.1  CG9556-RA, transcript variant A (alien), mRNA 
0   NM_078793.4  CG9556-RB, transcript variant B (alien), mRNA 
0   NM_080013.2  CG6050-RA (EfTuM), mRNA 
0   14  NM_057685.3  CG11527-RA (Tig), mRNA 
0   NM_057984.3  CG3460-RA (Nmd3), mRNA 
0   NM_135281.1  CG6630-RA (CG6630), mRNA 
0   NM_079913.2  CG8110-RA, transcript variant A (syd), mRNA 
0   NM_168245.2  CG8110-RB, transcript variant B (syd), mRNA 
0   NM_142803.1  CG5326-RA, transcript variant A (CG5326), mRNA 
0   NM_132681.1  CG15760-RA (CG15760), mRNA 
0   NM_137794.2  CG11073-RA (CG11073), mRNA 
0   NM_079455.3  CG12306-RA, transcript variant A (polo), mRNA 
0   NM_143439.2  CG2010-RB, transcript variant B (CG2010), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.