National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 6831R-1 
 Symbol rhea  Full Name rhea 
 CG No CG6831  Old CG No CG6831 
 Synonyms rhea, talin, Talin, CG6831, CT21159, Tln 
 Accession No (Link to NCBI) NM_139981.2 
 Inserted Chr. ll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
[Please submit your publication]
Xie X, Gilbert M, Petley-Ragan L, Auld VJ.
Loss of focal adhesions in glia disrupts both glial and photoreceptor axon migration in the Drosophila visual system.
Development (2014) 141(15) 3072-83 [ PubMed ID = 25053436 ] [ RRC reference ]

Yano H, Yamamoto-Hino M, Awano W, Aoki-Kinoshita KF, Tsuda-Sakurai K, Okano H, Goto S.
Identification of proteasome components required for apical localization of Chaoptin using functional genomics.
J. Neurogenet. (2012) 26(1) 53-63 [ PubMed ID = 22417167 ] [ RRC reference ]

Perkins AD, Ellis SJ, Asghari P, Shamsian A, Moore ED, Tanentzapf G.
Integrin-mediated adhesion maintains sarcomeric integrity.
Dev. Biol. (2009) 338(1) 15-27 [ PubMed ID = 19879257 ] [ RRC reference ]  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
 Primer Seq. 3'
 Predicted Fragment Size
 IR fragment full Seq
 in silico PCR Fragment
 Assemble Data

                          |||||||||||||||||||||||||||||||||| ||||| ||||||| ||||||||||| silico     1   CCATACAGTTCCAGCCCAACACCACAGTCTTCGA-TGCCT-GCAAGGT-CATTCGCGATA 60

                          ||||  |||||||| |||||||||||| |||||||||||||||| ||||||||||||||| silico     61  AGTT--CGCCGAGG-CAGTGCAAGGAC-AACCCAGCGAATATGG-ACTGTTTATCTCTGA 120

                           |||| |||||||||||||||||||||||| || |||||||||||||| ||||||||||| silico      121 TGAG-CAGAACCAGCAGGGGGTTTGGTTGGAA-CCGGGACGCACCCT-GGGCTACTACA 179

                          |||||||||| ||||||||||||||||||||||||| |||| |||   |||||||||||| silico     181 TACTGCACAA-CCAGGATACGCTGGAGTATCGCCGC-AAGA-CAC--GAACCCTACGTGT 239

                          ||  |||||||||||||||||||||||||||||||||||||||| ||||||||||||||| silico     241 TCGTATGTTGGATGGCGCTGTAAAGACCATTCTGGTGGATGACT-CCCAGCCGGTGTCGC 299

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     301 AGCTTATGGTGGTCATCTGCACAAAGATCGGCATCACCAATCATGAGGAATATGGATTGG 359

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     361 TGCGCGAGGACAATGAGGCGCAGAATGAGAATCTGCCGGACAACAAGTTTGGAACGCTTA 419

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     421 CCCTTAAGCGTAAGATTATGGAGAAGGATCGCGATGCCAAAATGGAGAGTTTGCGCAAGA 479

                          |||||||||||||||||||||||||||||||||||||| silico     481 AACTAAAGACGGACGATGAAATGAACTGGGTGGATGTG 517

 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_139981.2  CG6831-RA (rhea), mRNA 
0   NM_165878.1  CG30046-RB (CG30046), mRNA 
0   NM_078693.2  CG9565-RA (Nep3), mRNA 
0   NM_141248.2  CG31536-RC, transcript variant C (Cdep), mRNA 
0   NM_001043211.1  CG31536-RE, transcript variant E (Cdep), mRNA 
0   NM_169022.1  CG31536-RA, transcript variant A (Cdep), mRNA 
0   NM_139563.2  CG10359-RA (CG10359), mRNA 
0   NM_142753.2  CG5740-RB, transcript variant B (CG5740), mRNA 
0   NM_169996.1  CG5740-RA, transcript variant A (CG5740), mRNA 
0   NM_135778.1  CG16815-RA (CG16815), mRNA 
0   NM_079119.2  CG4354-RA (slbo), mRNA 
0   NM_135265.1  CG4971-RA (Wnt10), mRNA 
0   NM_135338.1  CG8673-RA (CG8673), mRNA 
0   NM_168357.2  CG32045-RB, transcript variant B (fry), mRNA 
0   NM_001043133.1  CG32045-RD, transcript variant D (fry), mRNA 
0   NM_133073.2  CG6394-RA, transcript variant A (GalNAc-T2), mRNA 
0   NM_167623.1  CG6394-RB, transcript variant B (GalNAc-T2), mRNA 
0   NM_164843.1  CG9556-RA, transcript variant A (alien), mRNA 
0   NM_078793.4  CG9556-RB, transcript variant B (alien), mRNA 
0   NM_080013.2  CG6050-RA (EfTuM), mRNA 
0   14  NM_057685.3  CG11527-RA (Tig), mRNA 
0   NM_057984.3  CG3460-RA (Nmd3), mRNA 
0   NM_135281.1  CG6630-RA (CG6630), mRNA 
0   NM_079913.2  CG8110-RA, transcript variant A (syd), mRNA 
0   NM_168245.2  CG8110-RB, transcript variant B (syd), mRNA 
0   NM_142803.1  CG5326-RA, transcript variant A (CG5326), mRNA 
0   NM_132681.1  CG15760-RA (CG15760), mRNA 
0   NM_137794.2  CG11073-RA (CG11073), mRNA 
0   NM_079455.3  CG12306-RA, transcript variant A (polo), mRNA 
0   NM_143439.2  CG2010-RB, transcript variant B (CG2010), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.