National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 6824R-2 
 Symbol ovo  Full Name ovo 
 CG No CG6824  Old CG No CG6824 
 Synonyms svb, CG15467, ovo/svb, Ovo-D, ovo/shavenbaby, OVO, CG6824, Svb, fs(1)K1237, Ovo, Fs(1)K1103, fs(1)M38, fs(1)M1, Fs(1)K155, Fs(1)K1237, ovo 
 Accession No (Link to NCBI) NM_167026.2 
 Inserted Chr. ll 
 Insertional Mutation  lethal 
 Phenotype induced by Act5C-GAL4 at 28 degrees pupal lethal 
 Map Viewer
 Reference
[Please submit your publication]
Kusama S, Ueda R, Suda T, Nishihara S, Matsuura ET.
Involvement of Drosophila Sir2-like genes in the regulation of life span.
Genes Genet. Syst. (2006) 81(5) 341-8 [ PubMed ID = 17159295 ] [ RRC reference ]

Cho Y, Lai CM, Lin KY, Hsu HJ.
A Targeted RNAi Screen Reveals Drosophila Female-Sterile Genes That Control the Size of Germline Stem Cell Niche During Development.
G3 (Bethesda) (2018) 8(7) 2345-2354 [ PubMed ID = 29764959 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgGGGAACTACGGACCCAATTCA 
 Primer Seq. 3'
aatctagaggtaccGGATTACCGCCGTAAAAGGGA 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 GGGAACTACG GACCCAATTC ACCGCCAACG GGAGCATTGC CTCCGTTTTA TGAGAGCCTC 
0061 AAGAGCGGCC AACAGAGCAC GGCCAGCAAC AATACGGGCC AAAGTCCCGG CGCTAATCAT 
0121 TCGCATTTCA ACGCAAATCC AGCGAATTTT CTGCAAAACG CAGCAGCGGC TGCGTANCCA 
0181 TCATGTCGGC AGGTTCCGGT GGAGGAGGCT GCACCGGAAA CGGAGGTGGT GGAGCATCGG 
0241 GGCCAGGAGG TGGNCCATCG GCAAATAGTG GTGGTGGTGG TGGTGGCGGC GGCGGCAATG 
0301 GGTACATCAA CTGTGGTGGT GTTGGTGGTC CAAACAATAG TCTCGACGGT AATAATCTAT 
0361 TGAACTTCGC CAGTGTTTCT AACTATAACG AATCCAATTC CAAATTCCAT AATCATCATC 
0421 ATCATCATCA ACACAACAAC AACAACAACA ACAATGGTGG TCAAACATCT ATGATGGGTC 
0481 ATCCCTTTTA CGGCGGTAAT CC 
 in silico PCR Fragment
0001 GGGAACTACG GACCCAATTC ACCGCCAACG GGAGCATTGC CTCCGTTTTA TGAGAGCCTC 
0061 AAGAGCGGCC AACAGAGCAC GGCCAGCAAC AATACGGGCC AAAGTCCCGG CGCTAATCAT 
0121 TCGCATTTCA ACGCAAATCC AGCGAATTTT CTGCAAAACG CAGCAGCGGC TGCGTA--CA 
0181 TCATGTCGGC AGGTTCCGGT GGAGGAGGCT GCACCGGAAA CGGAGGTGGT GGAGCATCGG 
0241 GGCCAGGAGG TGGCCCATCG GCAAATAGTG GTGGTGGTGG TGGTGGTGGC GGCGGCAATG 
0301 GGTACATCAA CTGTGGTGGT GTTGGTGGTC CAAACAATAG TCTCGACGGT AATAATCTAT 
0361 TGAACTTCGC CAGTGTTTCT AACTATAACG AATCCAATTC CAAATTCCAT AATCATCATC 
0421 ATCATCATCA ACACAACAAC AACAACAACA ACAATGGTGG TCAAACATCT ATGATGGGTC 
0481 ATCCCTTTTA CGGCGGTAAT CC 
 Assemble Data

6824R-2.IR_full       1   GGGAACTACGGACCCAATTCACCGCCAACGGGAGCATTGCCTCCGTTTTATGAGAGCCTC 60
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
6824R-2.in silico     1   GGGAACTACGGACCCAATTCACCGCCAACGGGAGCATTGCCTCCGTTTTATGAGAGCCTC 60


6824R-2.IR_full       61  AAGAGCGGCCAACAGAGCACGGCCAGCAACAATACGGGCCAAAGTCCCGGCGCTAATCAT 120
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
6824R-2.in silico     61  AAGAGCGGCCAACAGAGCACGGCCAGCAACAATACGGGCCAAAGTCCCGGCGCTAATCAT 120


6824R-2.IR_full       121 TCGCATTTCAACGCAAATCCAGCGAATTTTCTGCAAAACGCAGCAGCGGCTGCGTANCCA 180
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||  ||
6824R-2.in silico     121 TCGCATTTCAACGCAAATCCAGCGAATTTTCTGCAAAACGCAGCAGCGGCTGCGTA--CA 180


6824R-2.IR_full       181 TCATGTCGGCAGGTTCCGGTGGAGGAGGCTGCACCGGAAACGGAGGTGGTGGAGCATCGG 240
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
6824R-2.in silico     181 TCATGTCGGCAGGTTCCGGTGGAGGAGGCTGCACCGGAAACGGAGGTGGTGGAGCATCGG 240


6824R-2.IR_full       241 GGCCAGGAGGTGGNCCATCGGCAAATAGTGGTGGTGGTGGTGGTGGCGGCGGCGGCAATG 300
                          ||||||||||||| |||||||||||||||||||||||||||||||| |||||||||||||
6824R-2.in silico     241 GGCCAGGAGGTGGCCCATCGGCAAATAGTGGTGGTGGTGGTGGTGGTGGCGGCGGCAATG 300


6824R-2.IR_full       301 GGTACATCAACTGTGGTGGTGTTGGTGGTCCAAACAATAGTCTCGACGGTAATAATCTAT 360
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
6824R-2.in silico     301 GGTACATCAACTGTGGTGGTGTTGGTGGTCCAAACAATAGTCTCGACGGTAATAATCTAT 360


6824R-2.IR_full       361 TGAACTTCGCCAGTGTTTCTAACTATAACGAATCCAATTCCAAATTCCATAATCATCATC 420
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
6824R-2.in silico     361 TGAACTTCGCCAGTGTTTCTAACTATAACGAATCCAATTCCAAATTCCATAATCATCATC 420


6824R-2.IR_full       421 ATCATCATCAACACAACAACAACAACAACAACAATGGTGGTCAAACATCTATGATGGGTC 480
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
6824R-2.in silico     421 ATCATCATCAACACAACAACAACAACAACAACAATGGTGGTCAAACATCTATGATGGGTC 480


6824R-2.IR_full       481 ATCCCTTTTACGGCGGTAATCC 502
                          ||||||||||||||||||||||
6824R-2.in silico     481 ATCCCTTTTACGGCGGTAATCC 502

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100.82  486  28  46  110  NM_001038742.1  CG6824-RD, transcript variant D (ovo), mRNA 
100.82  486  28  44  108  NM_167026.2  CG6824-RB, transcript variant B (ovo), mRNA 
100.82  486  28  44  104  NM_167027.2  CG6824-RC, transcript variant C (ovo), mRNA 
68.46   330  21  25  54  NM_080338.3  CG6824-RA, transcript variant A (ovo), mRNA 
12.86   62  38  57  57  NM_078516.2  CG12690-RA (CHES-1-like), mRNA 
12.44   60  43  58  55  NM_140928.2  CG32223-RA (CG32223), mRNA 
9.54   46  43  91  191  NM_168571.2  CG32133-RA (CG32133), mRNA 
8.92   43  57  82  125  NM_168240.1  CG32365-RA (CG32365), mRNA 
4.35   21  32  47  76  NM_079002.2  CG3905-RA (Su(z)2), mRNA 
4.35   21  20  33  50  NM_057606.4  CG1759-RA, transcript variant A (cad), mRNA 
4.35   21  20  33  50  NM_134301.3  CG1759-RB, transcript variant B (cad), mRNA 
4.14   20  30  93  259  NM_079671.2  CG7847-RA, transcript variant A (sr), mRNA 
4.14   20  30  92  256  NM_169786.1  CG7847-RB, transcript variant B (sr), mRNA 
4.14   20  30  28  45  NM_132391.2  CG15307-RA (CG15307), mRNA 
3.94   19  35  40  58  NM_132214.1  CG15335-RB (CG15335), mRNA 
3.94   19  13  23  25  NM_080320.2  CG3653-RB, transcript variant B (kirre), mRNA 
3.73   18  34  81  112  NM_136854.1  CG13194-RA (pyr), mRNA 
3.52   17  20  32  40  NM_167015.2  CG6998-RC, transcript variant C (ctp), mRNA 
3.52   17  20  32  39  NM_080336.3  CG6998-RA, transcript variant A (ctp), mRNA 
3.52   17  20  32  39  NM_167016.1  CG6998-RD, transcript variant D (ctp), mRNA 
3.52   17  20  32  39  NM_167014.1  CG6998-RB, transcript variant B (ctp), mRNA 
3.52   17  13  23  36  NM_142701.2  CG5874-RA (CG5874), mRNA 
3.31   16  25  35  43  NM_132278.2  CG12075-RA, transcript variant A (CG12075), mRNA 
3.31   16  25  35  43  NM_206663.1  CG12075-RB, transcript variant B (CG12075), mRNA 
2.9   14  29  33  56  NM_169047.1  CG32464-RD, transcript variant D (l(3)82Fd), mRNA 
2.69   13  37  42  72  NM_167212.1  CG32694-RB, transcript variant B (CG32694), mRNA 
2.69   13  24  46  101  NM_134552.3  CG1412-RA (RhoGAP19D), mRNA 
2.69   13  12  24  45  NM_138988.2  CG11405-RA (A3-3), mRNA 
2.48   12  35  31  72  NM_166987.2  CG32781-RB (CG32781), mRNA 
2.48   12  31  40  54  NM_001038911.1  CG34050-RA (CG34050), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.