National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 6806R-2 
 Symbol Lsp2  Full Name Larval serum protein 2 
 CG No CG6806  Old CG No CG6806 
 Synonyms Lsp-2, CG6806, C23, DmeLSP2, LSP-2, LSP 2, Pt-1, LSP2, LHP, Lsp2 
 Accession No (Link to NCBI) NM_080077.2 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees viable 
 Map Viewer
 Reference
[Please submit your publication]
Shibata T, Ariki S, Shinzawa N, Miyaji R, Suyama H, Sako M, Inomata N, Koshiba T, Kanuka H, Kawabata S.
Protein crosslinking by transglutaminase controls cuticle morphogenesis in Drosophila.
PLoS ONE (2010) 5(10) e13477 [ PubMed ID = 20976106 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgGAAGTCGTTCACGGTGATTGC 
 Primer Seq. 3'
aatctagaggtaccATGGGTGGATCTCGTAGTGGG 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 NAAGTCGTTC ACGNTGATTG CGNTNGcTNC AGTGGCATTG CTGGCTACTC TCGGCCAGGC 
0061 CAAGCACCTG GACTCCAAGG TGGCGGACAA GGACTTTCTG ATGAAACAGA AGTTCATGTA 
0121 CCAGATCCTG CAGCACATCT ACCAGGACGA TGTGTTCACC ACNCCCTTCG GGGGCAGCTN 
0181 ACGTGGAGTA CAAGCCGTGG GAGCACGTGG CCGACTATGT GCACCCGGAG ATGTTGGAGC 
0241 ACTTCTTCGA GCTGTGGCAA CACCAACCCT TCACCGATGA CATGGTGTGG TCGGTGATGT 
0301 ACGACAAGCA CGAGGAGTAT GTGGTGGGTC TGGTGCGTCT CTTCTACTTC GCCAAGAACT 
0361 GGGAGACCTT CCAGCACGTC GTCTACTGGG CCCGCCAGCA CGTAAACAAG CAGTTGTTCG 
0421 TGTACGCCGT GACCATTGCC AGTTTGTTCC GTGATGATAT GCAGGGAGTC NNCCTGCCGG 
0481 CCCACTACGA GATCCACCCA T 
 in silico PCR Fragment
0001 GAAGTCGTTC ACGGTGATTG CGTTAGCTGC AGTGGCATTG CTGGCTACTC TCGGCCAGGC 
0061 CAAGCACCTG GACTCCAAGG TGGCGGACAA GGACTTTCTG ATGAAACAGA AGTTCATGTA 
0121 CCAGATCCTG CAGCACATCT ACCAGGACGA TGTGTTCACC ACGCCCTTCG GGGGCAGCT- 
0181 ACGTGGAGTA CAAGCCGTGG GAGCACGTGG CCGACTATGT GCACCCGGAG ATGTTGGAGC 
0241 ACTTCTTCGA GCTGTGGCAA CACCAACCCT TCACCGATGA CATGGTGTGG TCGGTGATGT 
0301 ACGACAAGCA CGAGGAGTAT GTGGTGGGTC TGGTGCGTCT CTTCTACTTC GCCAAGAACT 
0361 GGGAGACCTT CCAGCACGTC GTCTACTGGG CCCGCCAGCA CGTAAACAAG CAGTTGTTCG 
0421 TGTACGCCGT GACCATTGCC AGTTTGTTCC GTGATGATAT GCAGGGAGTC GTCCTGCCGG 
0481 CCCACTACGA GATCCACCCA T 
 Assemble Data

6806R-2.IR_full        1   AAGTCGTTCACGNTGATTGCGNTNGCTNCAGTGGCATTGCTGGCTACTCTCGGCCAGGC 59
                           |||||||||||| |||||||| | ||| |||||||||||||||||||||||||||||||
6806R-2.in silico      1   AAGTCGTTCACGGTGATTGCGTTAGCTGCAGTGGCATTGCTGGCTACTCTCGGCCAGGC 59


6806R-2.IR_full       61  CAAGCACCTGGACTCCAAGGTGGCGGACAAGGACTTTCTGATGAAACAGAAGTTCATGTA 119
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
6806R-2.in silico     61  CAAGCACCTGGACTCCAAGGTGGCGGACAAGGACTTTCTGATGAAACAGAAGTTCATGTA 119


6806R-2.IR_full       121 CCAGATCCTGCAGCACATCTACCAGGACGATGTGTTCACCACNCCCTTCGGGGGCAGCTN 179
                          |||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| 
6806R-2.in silico     121 CCAGATCCTGCAGCACATCTACCAGGACGATGTGTTCACCACGCCCTTCGGGGGCAGCT- 179


6806R-2.IR_full       181 ACGTGGAGTACAAGCCGTGGGAGCACGTGGCCGACTATGTGCACCCGGAGATGTTGGAGC 239
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
6806R-2.in silico     181 ACGTGGAGTACAAGCCGTGGGAGCACGTGGCCGACTATGTGCACCCGGAGATGTTGGAGC 239


6806R-2.IR_full       241 ACTTCTTCGAGCTGTGGCAACACCAACCCTTCACCGATGACATGGTGTGGTCGGTGATGT 299
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
6806R-2.in silico     241 ACTTCTTCGAGCTGTGGCAACACCAACCCTTCACCGATGACATGGTGTGGTCGGTGATGT 299


6806R-2.IR_full       301 ACGACAAGCACGAGGAGTATGTGGTGGGTCTGGTGCGTCTCTTCTACTTCGCCAAGAACT 359
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
6806R-2.in silico     301 ACGACAAGCACGAGGAGTATGTGGTGGGTCTGGTGCGTCTCTTCTACTTCGCCAAGAACT 359


6806R-2.IR_full       361 GGGAGACCTTCCAGCACGTCGTCTACTGGGCCCGCCAGCACGTAAACAAGCAGTTGTTCG 419
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
6806R-2.in silico     361 GGGAGACCTTCCAGCACGTCGTCTACTGGGCCCGCCAGCACGTAAACAAGCAGTTGTTCG 419


6806R-2.IR_full       421 TGTACGCCGTGACCATTGCCAGTTTGTTCCGTGATGATATGCAGGGAGTCNNCCTGCCGG 479
                          ||||||||||||||||||||||||||||||||||||||||||||||||||  ||||||||
6806R-2.in silico     421 TGTACGCCGTGACCATTGCCAGTTTGTTCCGTGATGATATGCAGGGAGTCGTCCTGCCGG 479


6806R-2.IR_full       481 CCCACTACGAGATCCACCCAT 500
                          |||||||||||||||||||||
6806R-2.in silico     481 CCCACTACGAGATCCACCCAT 500

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  10  NM_080077.2  CG6806-RA (Lsp2), mRNA 
97.51   470  10  NM_143790.1  CG11538-RA (CG11538), mRNA 
0   23  24  NM_057276.3  CG4178-RA (Lsp1beta), mRNA 
0   NM_166585.2  CG30189-RA (Gr59a), mRNA 
0   NM_133090.1  CG6696-RA (CG6696), mRNA 
0   NM_141559.3  CG8112-RA (CG8112), mRNA 
0   NM_165618.1  CG8579-RA (Jon44E), mRNA 
0   NM_138268.1  CG12084-RA (CG12084), mRNA 
0   NM_167145.1  CG2257-RA, transcript variant A (Ubc-E2H), mRNA 
0   NM_167146.1  CG2257-RC, transcript variant C (Ubc-E2H), mRNA 
0   NM_132210.2  CG2257-RB, transcript variant B (Ubc-E2H), mRNA 
0   NM_168252.1  CG7892-RB, transcript variant B (nmo), mRNA 
0   NM_168249.1  CG7892-RF, transcript variant F (nmo), mRNA 
0   NM_168251.1  CG7892-RA, transcript variant A (nmo), mRNA 
0   NM_168248.1  CG7892-RE, transcript variant E (nmo), mRNA 
0   NM_079243.2  CG7892-RC, transcript variant C (nmo), mRNA 
0   NM_168250.1  CG7892-RG, transcript variant G (nmo), mRNA 
0   NM_132040.1  CG15766-RA (CG15766), mRNA 
0   NM_134964.1  CG3921-RA (CG3921), mRNA 
0   NM_137739.2  CG10795-RA (CG10795), mRNA 
0   NM_144171.1  CG13479-RA (CG13479), mRNA 
0   NM_141130.3  CG11489-RB, transcript variant B (CG11489), mRNA 
0   NM_001014681.1  CG33553-RD, transcript variant D (Doa), mRNA 
0   NM_133020.2  CG6506-RA (CG6506), mRNA 
0   NM_141576.1  CG11775-RA (CG11775), mRNA 
0   NM_001043298.1  CG33553-RH, transcript variant H (Doa), mRNA 
0   NM_137701.2  CG4030-RA (CG4030), mRNA 
0   NM_001038936.2  CG33989-RE, transcript variant E (pHCl), mRNA 
0   NM_001038934.2  CG33989-RD, transcript variant D (pHCl), mRNA 
0   NM_143222.1  CG14237-RA (CG14237), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.