National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 6794R-1 
 Symbol Dif  Full Name Dorsal-related immunity factor 
 CG No CG6794  Old CG No CG6794 
 Synonyms dif, DIF, CG6794, Dif 
 Accession No (Link to NCBI) NM_078865.2 
 Inserted Chr. lll 
 Insertional Mutation  lethal 
 Phenotype induced by Act5C-GAL4 at 28 degrees viable 
 Map Viewer
 Reference
[Please submit your publication]
Yu S, Zhang G, Jin LH.
A high-sugar diet affects cellular and humoral immune responses in Drosophila.
Exp Cell Res (2018) 368(2) 215-224 [ PubMed ID = 29727694 ] [ RRC reference ]

Nagata R, Nakamura M, Sanaki Y, Igaki T.
Cell Competition Is Driven by Autophagy.
Dev Cell (2019) 51(1) 99-112.e4 [ PubMed ID = 31543447 ] [ RRC reference ]

Nitta Y, Yamazaki D, Sugie A, Hiroi M, Tabata T.
DISCO Interacting Protein 2 regulates axonal bifurcation and guidance of Drosophila mushroom body neurons.
Dev Biol (2017) 421(2) 233-244 [ PubMed ID = 27908785 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgGGCAGTGTGGCAGGAGCTGTT 
 Primer Seq. 3'
aatctagaggtaccGAGTCGCGCATCTCCAGCTTC 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 gGCAGNTGTG GCAGGAGCTG TTGGCGGANG cGGTGCTGCA CATCACATAT TATCGCAGTC 
0061 GACTTCCCTG CCGGTAATGC CGTCGCACAT TCCGCTCCAC CTGCAGAATC AGAATATGAA 
0121 TCAGAATCTG CCCGAGCCAA GTGCAAGAAG TGGTCCCCAC CTGCGTATCG TGGAGGAGCC 
0181 GACAAGCAAT ATAATCCGCT TTCGCTACAA ATGCGAGGGT CGCACCGCCG GTTCGATTCC 
0241 GGGCATGAAC TCCAGCTCGG AAACGGGCAA GACCTTTCCC ACCATCGAAG TGTGCAACTA 
0301 CGATGGACCC GTCATCATCG TGGTCTCCTG TGTGACGAGC GACGAGCCCT TNCCGCCAGC 
0361 ATCCCCACTG GCTGGTCAGC AAGGAGGAGG CGGATGCCTG CAAGTCGGGC ATCTACCAAA 
0421 AGAAATTGCC GCCAGAGGAG CGGCGGCTGG TGCTTCAAAA AGTGGGCATA CAGTGCGCCA 
0481 AGAAGCTGGA GATGCGCGAC TC 
 in silico PCR Fragment
0001 GGCAG-TGTG GCAGGAGCTG TTGGCGGAGG CGGTGCTGCA CATCACATAT TATCGCAGTC 
0061 GACTTCCCTG CCGGTAATGC CGTCGCACAT TCCGCTCCAC CTGCAGAATC AGAATATGAA 
0121 TCAGAATCTG CCCGAGCCAA GTGCAAGAAG TGGTCCCCAC CTGCGTATCG TGGAGGAGCC 
0181 GACAAGCAAT ATAATCCGCT TTCGCTACAA ATGCGAGGGT CGCACCGCCG GTTCGATTCC 
0241 GGGCATGAAC TCCAGCTCGG AAACGGGCAA GACCTTTCCC ACCATCGAAG TGTGCAACTA 
0301 CGATGGACCC GTCATCATCG TGGTCTCCTG TGTGACGAGC GACGAGCCCT T-CCGCCAGC 
0361 ATCCCCACTG GCTGGTCAGC AAGGAGGAGG CGGATGCCTG CAAGTCGGGC ATCTACCAAA 
0421 AGAAATTGCC GCCAGAGGAG CGGCGGCTGG TGCTCCAAAA AGTGGGCATA CAGTGCGCCA 
0481 AGAAGCTGGA GATGCGCGAC TC 
 Assemble Data

6794R-1.IR_full       1   GGCAGNTGTGGCAGGAGCTGTTGGCGGANGCGGTGCTGCACATCACATATTATCGCAGTC 60
                          ||||| |||||||||||||||||||||| |||||||||||||||||||||||||||||||
6794R-1.in silico     1   GGCAG-TGTGGCAGGAGCTGTTGGCGGAGGCGGTGCTGCACATCACATATTATCGCAGTC 60


6794R-1.IR_full       61  GACTTCCCTGCCGGTAATGCCGTCGCACATTCCGCTCCACCTGCAGAATCAGAATATGAA 120
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
6794R-1.in silico     61  GACTTCCCTGCCGGTAATGCCGTCGCACATTCCGCTCCACCTGCAGAATCAGAATATGAA 120


6794R-1.IR_full       121 TCAGAATCTGCCCGAGCCAAGTGCAAGAAGTGGTCCCCACCTGCGTATCGTGGAGGAGCC 180
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
6794R-1.in silico     121 TCAGAATCTGCCCGAGCCAAGTGCAAGAAGTGGTCCCCACCTGCGTATCGTGGAGGAGCC 180


6794R-1.IR_full       181 GACAAGCAATATAATCCGCTTTCGCTACAAATGCGAGGGTCGCACCGCCGGTTCGATTCC 240
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
6794R-1.in silico     181 GACAAGCAATATAATCCGCTTTCGCTACAAATGCGAGGGTCGCACCGCCGGTTCGATTCC 240


6794R-1.IR_full       241 GGGCATGAACTCCAGCTCGGAAACGGGCAAGACCTTTCCCACCATCGAAGTGTGCAACTA 300
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
6794R-1.in silico     241 GGGCATGAACTCCAGCTCGGAAACGGGCAAGACCTTTCCCACCATCGAAGTGTGCAACTA 300


6794R-1.IR_full       301 CGATGGACCCGTCATCATCGTGGTCTCCTGTGTGACGAGCGACGAGCCCTTNCCGCCAGC 360
                          ||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||
6794R-1.in silico     301 CGATGGACCCGTCATCATCGTGGTCTCCTGTGTGACGAGCGACGAGCCCTT-CCGCCAGC 360


6794R-1.IR_full       361 ATCCCCACTGGCTGGTCAGCAAGGAGGAGGCGGATGCCTGCAAGTCGGGCATCTACCAAA 420
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
6794R-1.in silico     361 ATCCCCACTGGCTGGTCAGCAAGGAGGAGGCGGATGCCTGCAAGTCGGGCATCTACCAAA 420


6794R-1.IR_full       421 AGAAATTGCCGCCAGAGGAGCGGCGGCTGGTGCTTCAAAAAGTGGGCATACAGTGCGCCA 480
                          |||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||
6794R-1.in silico     421 AGAAATTGCCGCCAGAGGAGCGGCGGCTGGTGCTCCAAAAAGTGGGCATACAGTGCGCCA 480


6794R-1.IR_full       481 AGAAGCTGGAGATGCGCGACTC 502
                          ||||||||||||||||||||||
6794R-1.in silico     481 AGAAGCTGGAGATGCGCGACTC 502

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_078865.2  CG6794-RA, transcript variant A (Dif), mRNA 
100   482  NM_165216.1  CG6794-RB, transcript variant B (Dif), mRNA 
0.62   NM_057746.3  CG11992-RA, transcript variant A (Rel), mRNA 
0.62   NM_206467.1  CG11992-RB, transcript variant B (Rel), mRNA 
0.62   NM_206466.1  CG11992-RC, transcript variant C (Rel), mRNA 
0.62   NM_206465.1  CG11992-RD, transcript variant D (Rel), mRNA 
0   NM_168156.1  CG7018-RA, transcript variant A (Ets65A), mRNA 
0   NM_079221.2  CG7018-RB, transcript variant B (Ets65A), mRNA 
0   NM_130478.2  CG2995-RA (CG2995), mRNA 
0   NM_170304.1  CG31075-RA (CG31075), mRNA 
0   NM_167538.1  CG32572-RA (CG32572), mRNA 
0   NM_141009.2  CG32432-RA (CG32432), mRNA 
0   NM_165698.1  CG1623-RA, transcript variant A (CG1623), mRNA 
0   NM_136676.2  CG1623-RC, transcript variant C (CG1623), mRNA 
0   NM_057325.2  CG3440-RA (Pcp), mRNA 
0   NM_165700.1  CG1623-RD, transcript variant D (CG1623), mRNA 
0   NM_165699.1  CG1623-RB, transcript variant B (CG1623), mRNA 
0   NM_165701.1  CG1623-RE, transcript variant E (CG1623), mRNA 
0   NM_136527.1  CG14755-RA (CG14755), mRNA 
0   NM_143210.2  CG31323-RA (CG31323), mRNA 
0   NM_170355.2  CG12877-RB, transcript variant B (CG12877), mRNA 
0   NM_143327.2  CG12877-RA, transcript variant A (CG12877), mRNA 
0   NM_001038984.1  CG12877-RC, transcript variant C (CG12877), mRNA 
0   NM_141219.1  CG1078-RA (CG1078), mRNA 
0   NM_078997.1  CG17584-RA (Or49b), mRNA 
0   NM_135082.2  CG6604-RA (H15), mRNA 
0   NM_133124.1  CG7502-RA (CG7502), mRNA 
0   NM_136191.2  CG31688-RA (CG31688), mRNA 
0   NM_140557.3  CG6114-RA (CG6114), mRNA 
0   NM_132034.1  CG3108-RA (CG3108), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.