National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 6759R-3 
 Symbol cdc16  Full Name cdc16 
 CG No CG6759  Old CG No CG6759 
 Synonyms Dmcdc16, CG6759, cdc16, Cdc16 
 Accession No (Link to NCBI) NM_058049.4 
 Inserted Chr.
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
 Reference
[Please submit your publication]
Zielke N, Querings S, Rottig C, Lehner C, Sprenger F.
The anaphase-promoting complex/cyclosome (APC/C) is required for rereplication control in endoreplication cycles.
Genes Dev. (2008) 22(12) 1690-703 [ PubMed ID = 18559483 ] [ RRC reference ]

Molnar C, Casado M, López-Varea A, Cruz C, de Celis JF.
Genetic annotation of gain-of-function screens using RNA interference and in situ hybridization of candidate genes in the Drosophila wing.
Genetics (2012) 192(2) 741-52 [ PubMed ID = 22798488 ] [ RRC reference ]

Umemori M, Habara O, Iwata T, Maeda K, Nishinoue K, Okabe A, Takemura M, Takahashi K, Saigo K, Ueda R, Adachi-Yamada T.
RNAi-mediated knockdown showing impaired cell survival in Drosophila wing imaginal disc.
Gene Regul Syst Bio (2009) 3 11-20 [ PubMed ID = 19838331 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgACCGGCAGCTGGTCAAACAAT 
 Primer Seq. 3'
aatctagaggtaccGGCCTCAAAGCAGTATATGGA 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 ACCGGCAGCT GGTCAAACAA TTNCATAGAC ATGCGTCGCT ACTCCACAGC GCTTTTTTGG 
0061 GCAGAAAAGG TGGCCGTGCT TGGTGGCCTG GAACCCAGGG ATATTTACTA CCAGGCGCAG 
0121 TGCATGTACC TACTGGGGGA ATACCATCGT GCTGCTCACA CAATACAGCA TCACAAGCTA 
0181 GAGAAGAATT CACTGCCATG TTTTAACCTA CTACTGGAAA GTCTCTATGC GGCCAAGGAG 
0241 TTTACCGAGG CGGCCAATGT CATCCAGAAT GTGGAGGTGG AAGTCATGAC CACATCGCTG 
0301 ATCAACCAGC CCGTTGATGC AAGCAGTGGC TGCTATCTGG AAAGCAACAG TGTCTTTGGT 
0361 GGCGAGGAGA ATCACAGAAA TGAACTGCTC TCATCCATTT ACCTAATGAA GGGCAAAGTT 
0421 TATGAGGCCC TGGACAATCG CGGCATGGCA ATGGACTTCT ATGTTCAGGC CCTTCACAAA 
0481 TCCATATACT GCTTTGNAGG CC 
 in silico PCR Fragment
0001 ACCGGCAGCT GGTCAAACAA TT-CATAGAC ATGCGTCGCT ACTCCACAGC GCTTTTTTGG 
0061 GCAGAAAAGG TGGCCGTGCT TGGTGGCCTG GAACCCAGGG ATATTTACTA CCAGGCGCAG 
0121 TGCATGTACC TACTGGGGGA ATACCATCGT GCTGCTCACA CAATACAGCA TCACAAGCTA 
0181 GAGAAGAATT CACTGCCATG TTTTAACCTA CTACTGGAAA GTCTCTATGC GGCCAAGGAG 
0241 TTTACCGAGG CGGCCAATGT CATCCAGAAT GTGGAGGTGG AAGTCATGAC CACATCGCTG 
0301 ATCAACCAGC CCGTTGATGC AAGCAGTGGC TGCTATCTGG AAAGCAACAG TGTCTTTGGT 
0361 GGCGAGGAGA ATCACAGAAA TGAACTGCTC TCATCCATTT ACCTAATGAA GGGCAAAGTT 
0421 TATGAGGCCC TGGACAATCG CGGCATGGCA ATGGACTTCT ATGTTCAGGC CCTTCACAAA 
0481 TCCATATACT GCTTTG-AGG CC 
 Assemble Data

6759R-3.IR_full       1   ACCGGCAGCTGGTCAAACAATTNCATAGACATGCGTCGCTACTCCACAGCGCTTTTTTGG 60
                          |||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||
6759R-3.in silico     1   ACCGGCAGCTGGTCAAACAATT-CATAGACATGCGTCGCTACTCCACAGCGCTTTTTTGG 60


6759R-3.IR_full       61  GCAGAAAAGGTGGCCGTGCTTGGTGGCCTGGAACCCAGGGATATTTACTACCAGGCGCAG 120
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
6759R-3.in silico     61  GCAGAAAAGGTGGCCGTGCTTGGTGGCCTGGAACCCAGGGATATTTACTACCAGGCGCAG 120


6759R-3.IR_full       121 TGCATGTACCTACTGGGGGAATACCATCGTGCTGCTCACACAATACAGCATCACAAGCTA 180
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
6759R-3.in silico     121 TGCATGTACCTACTGGGGGAATACCATCGTGCTGCTCACACAATACAGCATCACAAGCTA 180


6759R-3.IR_full       181 GAGAAGAATTCACTGCCATGTTTTAACCTACTACTGGAAAGTCTCTATGCGGCCAAGGAG 240
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
6759R-3.in silico     181 GAGAAGAATTCACTGCCATGTTTTAACCTACTACTGGAAAGTCTCTATGCGGCCAAGGAG 240


6759R-3.IR_full       241 TTTACCGAGGCGGCCAATGTCATCCAGAATGTGGAGGTGGAAGTCATGACCACATCGCTG 300
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
6759R-3.in silico     241 TTTACCGAGGCGGCCAATGTCATCCAGAATGTGGAGGTGGAAGTCATGACCACATCGCTG 300


6759R-3.IR_full       301 ATCAACCAGCCCGTTGATGCAAGCAGTGGCTGCTATCTGGAAAGCAACAGTGTCTTTGGT 360
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
6759R-3.in silico     301 ATCAACCAGCCCGTTGATGCAAGCAGTGGCTGCTATCTGGAAAGCAACAGTGTCTTTGGT 360


6759R-3.IR_full       361 GGCGAGGAGAATCACAGAAATGAACTGCTCTCATCCATTTACCTAATGAAGGGCAAAGTT 420
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
6759R-3.in silico     361 GGCGAGGAGAATCACAGAAATGAACTGCTCTCATCCATTTACCTAATGAAGGGCAAAGTT 420


6759R-3.IR_full       421 TATGAGGCCCTGGACAATCGCGGCATGGCAATGGACTTCTATGTTCAGGCCCTTCACAAA 480
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
6759R-3.in silico     421 TATGAGGCCCTGGACAATCGCGGCATGGCAATGGACTTCTATGTTCAGGCCCTTCACAAA 480


6759R-3.IR_full       481 TCCATATACTGCTTTGNAGGCC 502
                          |||||||||||||||| |||||
6759R-3.in silico     481 TCCATATACTGCTTTG-AGGCC 502

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_058049.4  CG6759-RA (cdc16), mRNA 
0   59  144  417  NM_167482.3  CG32580-RA (CG32580), mRNA 
0   NM_142425.2  CG7212-RA (cdm), mRNA 
0   NM_057388.2  CG9224-RA (sog), mRNA 
0   NM_057774.3  CG1019-RA, transcript variant A (Mlp84B), mRNA 
0   NM_169173.1  CG1019-RB, transcript variant B (Mlp84B), mRNA 
0   NM_133163.3  CG9397-RA (1.28), mRNA 
0   NM_167475.1  CG17336-RA, transcript variant A (Lcch3), mRNA 
0   NM_206746.1  CG17336-RC, transcript variant C (Lcch3), mRNA 
0   NM_078632.2  CG17336-RB, transcript variant B (Lcch3), mRNA 
0   NM_079277.2  CG3705-RA (aay), mRNA 
0   NM_057810.3  CG11567-RA, transcript variant A (Cpr), mRNA 
0   NM_164689.1  CG11567-RB, transcript variant B (Cpr), mRNA 
0   NM_176041.1  CG33090-RB (CG33090), mRNA 
0   NM_136119.1  CG16771-RA (CG16771), mRNA 
0   NM_079110.2  CG11182-RA (PHDP), mRNA 
0   NM_057823.4  CG4212-RA, transcript variant A (Rab14), mRNA 
0   NM_176042.1  CG4212-RB, transcript variant B (Rab14), mRNA 
0   NM_176043.1  CG4212-RC, transcript variant C (Rab14), mRNA 
0   NM_136498.1  CG11198-RA, transcript variant A (CG11198), mRNA 
0   NM_165581.1  CG11198-RB, transcript variant B (CG11198), mRNA 
0   NM_138990.2  CG17176-RA (ACXA), mRNA 
0   NM_058008.3  CG12363-RA (Dlc90F), mRNA 
0   NM_079151.2  CG3217-RA, transcript variant A (CkIIalpha-i3), mRNA 
0   NM_167840.1  CG3217-RB, transcript variant B (CkIIalpha-i3), mRNA 
0   NM_079564.3  CG8874-RA, transcript variant A (Fps85D), mRNA 
0   NM_132641.1  CG15743-RA (CG15743), mRNA 
0   NM_132924.2  CG4678-RA, transcript variant A (CG4678), mRNA 
0   NM_001038761.1  CG4678-RC, transcript variant C (CG4678), mRNA 
0   NM_167536.2  CG4678-RB, transcript variant B (CG4678), mRNA 
 Wing Disc
GFP
Puc
Caspase
DAPI
Merge
Figure
JNK signal
N
++ 
DB
++ 
DC
++ 
DM
++ 
VM
VB
 
Caspase-3 signal
N
++ 
DB
++ 
DC
++ 
DM
++  
VM
VB
 
Dcompartment   Penetrance
++     

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.