National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 6751R-1 
 Symbol CG6751  Full Name CG6751 
 CG No CG6751  Old CG No CG6751 
 Synonyms CG6751 
 Accession No (Link to NCBI) NM_136779.2 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
 Reference
[Please submit your publication]
Hasygar K, Deniz O, Liu Y, Gullmets J, Hynynen R, Ruhanen H, Kokki K, Käkelä R, Hietakangas V.
Coordinated control of adiposity and growth by anti-anabolic kinase ERK7.
EMBO Rep (2020) e201949602 [ PubMed ID = 33369866 ] [ RRC reference ]

Liu Y, Mattila J, Ventelä S, Yadav L, Zhang W, Lamichane N, Sundström J, Kauko O, Grénman R, Varjosalo M, Westermarck J, Hietakangas V.
PWP1 Mediates Nutrient-Dependent Growth Control through Nucleolar Regulation of Ribosomal Gene Expression.
Dev Cell (2017) 43(2) 240-252.e5 [ PubMed ID = 29065309 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgGCCGAGCATTGATTTTGTCCC 
 Primer Seq. 3'
aatctagaggtaccACAGAGGAAAGCTTGGCAGCA 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 GCCGAGCATT GATTTTGTCC CAGCTCTTTG CTTTGTACCA CGCGGCGTgG CTAAGGATCG 
0061 TCCCGACAAG ATCGTGCTGA CGCAGGCGGA gcTGNGCCAG GATTATCGGT GATACGCAAC 
0121 AGGAATTGGA CGAGGAGAGC GACGACGATG CAGAGGAGGG CGAAAATGCC GAGGAAGACC 
0181 AAAACGACAT GGATGTGGAC GACCACGCGG ATGCCAATAG TGAGAACCGC GATCCGCAGG 
0241 ACGAGTTCCA ATTCCAGGAG TATGACAACG AGGCGAATGC TAATGTCACC AGTCTGGCCA 
0301 ACATCGTGGA CGCTGGCGAG CAAATCCCCG ATGAGGACGA AGACTCCGAG GCCGAGGACG 
0361 AGGTGATCAA GCCCAGCGAC AACCTCATTC TAGTGGGTCA CGTTCAAGAC GACGCCGCCT 
0421 CCATGGAGGT GTGGGTTTTC AACCAGGAGG AGGAGGCTCT CTACACCCAC CACGACTTTC 
0481 TGCTGCCAAG CTTTCCTCTG T 
 in silico PCR Fragment
0001 GCCGAGCATT GATTTTGTCC CAGCTCTTTG CTTTGTACCA CGCGGCGTGG CTAAGGATCG 
0061 TCCCGACAAG ATCGTGCTGA CGCAGGCGGA GCTG-GCCAG GATTATCGGT GATACGCAAC 
0121 AGGAATTGGA CGAGGAGAGC GACGACGATG CAGAGGAGGG CGAAAATGCC GAGGAAGACC 
0181 AAAACGACAT GGATGTGGAC GACCACGCGG ATGCCAATAG TGAGAACCGC GATCCGCAGG 
0241 ACGAGTTCCA ATTCCAGGAG TATGACAACG AGGCGAATGC TAATGTCACC AGTCTGGCCA 
0301 ACATCGTGGA CGCTGGCGAG CAAATCCCCG ATGAGGACGA AGACTCCGAG GCCGAGGACG 
0361 AGGTGATCAA GCCCAGCGAC AACCTCATTC TAGTGGGTCA CGTTCAAGAC GACGCCGCCT 
0421 CCATGGAGGT GTGGGTTTTC AACCAGGAGG AGGAGGCTCT CTACACCCAC CACGACTTTC 
0481 TGCTGCCAAG CTTTCCTCTG T 
 Assemble Data

6751R-1.IR_full       1   GCCGAGCATTGATTTTGTCCCAGCTCTTTGCTTTGTACCACGCGGCGTGGCTAAGGATCG 60
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
6751R-1.in silico     1   GCCGAGCATTGATTTTGTCCCAGCTCTTTGCTTTGTACCACGCGGCGTGGCTAAGGATCG 60


6751R-1.IR_full       61  TCCCGACAAGATCGTGCTGACGCAGGCGGAGCTGNGCCAGGATTATCGGTGATACGCAAC 120
                          |||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||
6751R-1.in silico     61  TCCCGACAAGATCGTGCTGACGCAGGCGGAGCTG-GCCAGGATTATCGGTGATACGCAAC 120


6751R-1.IR_full       121 AGGAATTGGACGAGGAGAGCGACGACGATGCAGAGGAGGGCGAAAATGCCGAGGAAGACC 180
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
6751R-1.in silico     121 AGGAATTGGACGAGGAGAGCGACGACGATGCAGAGGAGGGCGAAAATGCCGAGGAAGACC 180


6751R-1.IR_full       181 AAAACGACATGGATGTGGACGACCACGCGGATGCCAATAGTGAGAACCGCGATCCGCAGG 240
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
6751R-1.in silico     181 AAAACGACATGGATGTGGACGACCACGCGGATGCCAATAGTGAGAACCGCGATCCGCAGG 240


6751R-1.IR_full       241 ACGAGTTCCAATTCCAGGAGTATGACAACGAGGCGAATGCTAATGTCACCAGTCTGGCCA 300
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
6751R-1.in silico     241 ACGAGTTCCAATTCCAGGAGTATGACAACGAGGCGAATGCTAATGTCACCAGTCTGGCCA 300


6751R-1.IR_full       301 ACATCGTGGACGCTGGCGAGCAAATCCCCGATGAGGACGAAGACTCCGAGGCCGAGGACG 360
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
6751R-1.in silico     301 ACATCGTGGACGCTGGCGAGCAAATCCCCGATGAGGACGAAGACTCCGAGGCCGAGGACG 360


6751R-1.IR_full       361 AGGTGATCAAGCCCAGCGACAACCTCATTCTAGTGGGTCACGTTCAAGACGACGCCGCCT 420
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
6751R-1.in silico     361 AGGTGATCAAGCCCAGCGACAACCTCATTCTAGTGGGTCACGTTCAAGACGACGCCGCCT 420


6751R-1.IR_full       421 CCATGGAGGTGTGGGTTTTCAACCAGGAGGAGGAGGCTCTCTACACCCACCACGACTTTC 480
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
6751R-1.in silico     421 CCATGGAGGTGTGGGTTTTCAACCAGGAGGAGGAGGCTCTCTACACCCACCACGACTTTC 480


6751R-1.IR_full       481 TGCTGCCAAGCTTTCCTCTGT 501
                          |||||||||||||||||||||
6751R-1.in silico     481 TGCTGCCAAGCTTTCCTCTGT 501

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_136779.2  CG6751-RA (CG6751), mRNA 
0.2   NM_137398.1  CG4954-RA (eIF3-S8), mRNA 
0.2   11  NM_139422.2  CG1017-RA (CG1017), mRNA 
0   NM_206050.1  CG11140-RE, transcript variant E (Aldh-III), mRNA 
0   NM_165531.1  CG11140-RF, transcript variant F (Aldh-III), mRNA 
0   NM_165530.1  CG11140-RD, transcript variant D (Aldh-III), mRNA 
0   NM_165527.1  CG11140-RA, transcript variant A (Aldh-III), mRNA 
0   NM_165526.1  CG11140-RI, transcript variant I (Aldh-III), mRNA 
0   NM_165528.1  CG11140-RB, transcript variant B (Aldh-III), mRNA 
0   NM_165529.1  CG11140-RC, transcript variant C (Aldh-III), mRNA 
0   NM_165532.1  CG11140-RG, transcript variant G (Aldh-III), mRNA 
0   NM_136441.2  CG11140-RH, transcript variant H (Aldh-III), mRNA 
0   NM_079503.2  CG9761-RA (Nep2), mRNA 
0   NM_079939.2  CG5580-RA, transcript variant A (sbb), mRNA 
0   NM_206161.1  CG5580-RB, transcript variant B (sbb), mRNA 
0   NM_206162.1  CG5580-RC, transcript variant C (sbb), mRNA 
0   NM_166690.1  CG30420-RA, transcript variant A (Atf-2), mRNA 
0   NM_141854.2  CG14722-RA (CG14722), mRNA 
0   NM_136849.1  CG30035-RA, transcript variant A (CG30035), mRNA 
0   NM_142531.1  CG14282-RA (CG14282), mRNA 
0   NM_138130.2  CG30420-RB, transcript variant B (Atf-2), mRNA 
0   NM_142956.1  CG18428-RA (CG18428), mRNA 
0   NM_001014576.1  CG7391-RD, transcript variant D (Clk), mRNA 
0   NM_001014575.1  CG7391-RE, transcript variant E (Clk), mRNA 
0   NM_001014574.1  CG7391-RF, transcript variant F (Clk), mRNA 
0   NM_079240.2  CG7391-RA, transcript variant A (Clk), mRNA 
0   NM_206299.1  CG7391-RC, transcript variant C (Clk), mRNA 
0   NM_170628.1  CG7391-RB, transcript variant B (Clk), mRNA 
0   NM_132569.1  CG11245-RA (CG11245), mRNA 
0   NM_135432.1  CG13108-RA (CG13108), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.