National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
Notice:

Suspension of shipments during Golden Week Holidays: From 4 May to 11 May, deadline 21 April.

NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 6716R-1 
 Symbol prd  Full Name paired 
 CG No CG6716  Old CG No CG6716 
 Synonyms Prd, pr, CG6716, prd 
 Accession No (Link to NCBI) NM_078832.2 
 Inserted Chr. ll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees viable 
 Map Viewer
 Reference
[Please submit your publication]
Ito S, Ueda T, Ueno A, Nakagawa H, Taniguchi H, Kayukawa N, Miki T.
A genetic screen in Drosophila for regulators of human prostate cancer progression.
Biochem Biophys Res Commun (2014) 451(4) 548-55 [ PubMed ID = 25117438 ] [ RRC reference ]

Nitta Y, Yamazaki D, Sugie A, Hiroi M, Tabata T.
DISCO Interacting Protein 2 regulates axonal bifurcation and guidance of Drosophila mushroom body neurons.
Dev Biol (2017) 421(2) 233-244 [ PubMed ID = 27908785 ] [ RRC reference ]

Umetsu D, Dunst S, Dahmann C.
An RNA interference screen for genes required to shape the anteroposterior compartment boundary in Drosophila identifies the Eph receptor.
PLoS One (2014) 9(12) e114340 [ PubMed ID = 25473846 ] [ RRC reference ]

Umemori M, Habara O, Iwata T, Maeda K, Nishinoue K, Okabe A, Takemura M, Takahashi K, Saigo K, Ueda R, Adachi-Yamada T.
RNAi-mediated knockdown showing impaired cell survival in Drosophila wing imaginal disc.
Gene Regul Syst Bio (2009) 3 11-20 [ PubMed ID = 19838331 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgAACGGTCGTCCTTTGCCCAAC 
 Primer Seq. 3'
aatctagaggtaccCCCGGCTCACTTTCACAGTCA 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 AACGGTCGTC CTTTGCCCAA CAATATTCGT CTTAAAATCG TCGAGATGGC CGCCGATGGC 
0061 ATTCGGCCCT GTGTGATCTC CAGACAGCTA CGTGTGTCCC ATGGCTGCGT ATCGAAGATC 
0121 CTGAATCGCT ACCAGGAGAC TGGCTCCATT AGACCAGGCG TAATTGGTGG CTCCAAGCCG 
0181 AGGATANGCC ACGCCCGAAA TCGAAAACCG AATTGAGGAG TACAAGCGCA GTAGCCCGGG 
0241 CATGTTCTCG TGGGAGATCA GGGAGAAGCT GATCCGCGAG GGAGTCTGCG ACAGGAGCAC 
0301 AGCACCATCT GTGTCCGCCA TATCGCGCCT GGTGCGCGGC CGNAGATGCT CCATTGGACA 
0361 ATGATATGTC TTCTGCCTCT GGATCTCCGG CGGGTGATGG CACCAAAGCA TCGAGTTCCT 
0421 GCGGCTCCGA TGTCTCAGGT GGCCATCACA ACAACGGCAA GCCCTCCGAT GAGGACATCT 
0481 CTGACTGTGA AAGTGAGCCG GG 
 in silico PCR Fragment
0001 AACGGTCGTC CTTTGCCCAA CAATATTCGT CTTAAAATCG TCGAGATGGC CGCCGATGGC 
0061 ATTCGGCCCT GTGTGATCTC CAGACAGCTA CGTGTGTCCC ATGGCTGCGT ATCGAAGATC 
0121 CTGAATCGCT ACCAGGAGAC TGGCTCCATT AGACCAGGCG TAATTGGTGG CTCCAAGCCG 
0181 AGGATA-GCC ACGCCCGAAA TCGAGAACCG AATTGAGGAG TACAAGCGCA GTAGCCCGGG 
0241 CATGTTCTCG TGGGAGATCA GGGAGAAGCT GATCCGCGAG GGTGTCTGCG ACAGGAGCAC 
0301 AGCACCATCT GTGTCCGCCA TATCGCGCCT GGTGCGCGGC CG-AGATGCT CCATTGGACA 
0361 ATGATATGTC TTCTGCCTCT GGATCTCCGG CGGGTGATGG CACCAAAGCA TCGAGTTCCT 
0421 GCGGCTCCGA TGTCTCAGGT GGCCATCACA ACAACGGCAA GCCCTCCGAT GAGGACATCT 
0481 CTGACTGTGA AAGTGAGCCG GG 
 Assemble Data

6716R-1.IR_full       1   AACGGTCGTCCTTTGCCCAACAATATTCGTCTTAAAATCGTCGAGATGGCCGCCGATGGC 60
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
6716R-1.in silico     1   AACGGTCGTCCTTTGCCCAACAATATTCGTCTTAAAATCGTCGAGATGGCCGCCGATGGC 60


6716R-1.IR_full       61  ATTCGGCCCTGTGTGATCTCCAGACAGCTACGTGTGTCCCATGGCTGCGTATCGAAGATC 120
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
6716R-1.in silico     61  ATTCGGCCCTGTGTGATCTCCAGACAGCTACGTGTGTCCCATGGCTGCGTATCGAAGATC 120


6716R-1.IR_full       121 CTGAATCGCTACCAGGAGACTGGCTCCATTAGACCAGGCGTAATTGGTGGCTCCAAGCCG 180
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
6716R-1.in silico     121 CTGAATCGCTACCAGGAGACTGGCTCCATTAGACCAGGCGTAATTGGTGGCTCCAAGCCG 180


6716R-1.IR_full       181 AGGATANGCCACGCCCGAAATCGAAAACCGAATTGAGGAGTACAAGCGCAGTAGCCCGGG 240
                          |||||| ||||||||||||||||| |||||||||||||||||||||||||||||||||||
6716R-1.in silico     181 AGGATA-GCCACGCCCGAAATCGAGAACCGAATTGAGGAGTACAAGCGCAGTAGCCCGGG 240


6716R-1.IR_full       241 CATGTTCTCGTGGGAGATCAGGGAGAAGCTGATCCGCGAGGGAGTCTGCGACAGGAGCAC 300
                          |||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||
6716R-1.in silico     241 CATGTTCTCGTGGGAGATCAGGGAGAAGCTGATCCGCGAGGGTGTCTGCGACAGGAGCAC 300


6716R-1.IR_full       301 AGCACCATCTGTGTCCGCCATATCGCGCCTGGTGCGCGGCCGNAGATGCTCCATTGGACA 360
                          |||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||
6716R-1.in silico     301 AGCACCATCTGTGTCCGCCATATCGCGCCTGGTGCGCGGCCG-AGATGCTCCATTGGACA 360


6716R-1.IR_full       361 ATGATATGTCTTCTGCCTCTGGATCTCCGGCGGGTGATGGCACCAAAGCATCGAGTTCCT 420
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
6716R-1.in silico     361 ATGATATGTCTTCTGCCTCTGGATCTCCGGCGGGTGATGGCACCAAAGCATCGAGTTCCT 420


6716R-1.IR_full       421 GCGGCTCCGATGTCTCAGGTGGCCATCACAACAACGGCAAGCCCTCCGATGAGGACATCT 480
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
6716R-1.in silico     421 GCGGCTCCGATGTCTCAGGTGGCCATCACAACAACGGCAAGCCCTCCGATGAGGACATCT 480


6716R-1.IR_full       481 CTGACTGTGAAAGTGAGCCGGG 502
                          ||||||||||||||||||||||
6716R-1.in silico     481 CTGACTGTGAAAGTGAGCCGGG 502

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_164990.2  CG6716-RB, transcript variant B (prd), mRNA 
100   482  NM_078832.2  CG6716-RA, transcript variant A (prd), mRNA 
0.2   11  34  NM_079139.2  CG3388-RA (gsb), mRNA 
0   19  42  NM_079138.1  CG2692-RA (gsb-n), mRNA 
0   NM_143409.1  CG11873-RA (CG11873), mRNA 
0   16  NM_079317.2  CG10704-RA (toe), mRNA 
0   NM_139759.1  CG6592-RA (CG6592), mRNA 
0   NM_167943.1  CG32304-RA (CG32304), mRNA 
0   NM_169609.1  CG31304-RA (CG31304), mRNA 
0   NM_132540.1  CG2467-RA, transcript variant A (CG2467), mRNA 
0   NM_167313.1  CG2467-RB, transcript variant B (CG2467), mRNA 
0   NM_079318.2  CG10488-RA, transcript variant A (eyg), mRNA 
0   NM_001014582.1  CG10488-RB, transcript variant B (eyg), mRNA 
0   NM_144457.2  CG18530-RA (CG18530), mRNA 
0   NM_141602.2  CG11982-RA (CG11982), mRNA 
0   NM_139758.1  CG10475-RA (Jon65Ai), mRNA 
0   NM_079869.2  CG1528-RA, transcript variant A (gammaCop), mRNA 
0   NM_170553.1  CG1528-RB, transcript variant B (gammaCop), mRNA 
0   NM_140321.1  CG10660-RA (CG10660), mRNA 
0   NM_001042910.1  CG11628-RB, transcript variant B (Grp1), mRNA 
0   NM_079398.2  CG7930-RA, transcript variant A (TpnC73F), mRNA 
0   NM_168715.1  CG7930-RB, transcript variant B (TpnC73F), mRNA 
0   16  NM_057338.2  CG8246-RA (Poxn), mRNA 
0   NM_079808.2  CG5658-RA (Klp98A), mRNA 
0   NM_167541.1  CG32569-RA (CG32569), mRNA 
0   NM_141000.1  CG3698-RA (CG3698), mRNA 
0   20  NM_001043222.1  CG9610-RC (Poxm), mRNA 
0   NM_143745.2  CG18389-RA (Eip93F), mRNA 
0   NM_078869.4  CG15154-RB, transcript variant B (Socs36E), mRNA 
0   NM_165243.1  CG15154-RA, transcript variant A (Socs36E), mRNA 
 Wing Disc
GFP
Puc
Caspase
DAPI
Merge
Figure
JNK signal
N
 
DB
 
DC
+- 
DM
 
VM
 
VB
 
Caspase-3 signal
N
DB
DC
DM
 
VM
 
VB
 
Dcompartment   Penetrance
     

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.