National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 6667R-2 
 Symbol dl  Full Name dorsal 
 CG No CG6667  Old CG No CG6667 
 Synonyms CG6667, dL, fs(2)k10816, anon-EST:GressD7, mat(2)dorsal, dl, Dl 
 Accession No (Link to NCBI) NM_165217.1 
 Inserted Chr. lll 
 Insertional Mutation  lethal 
 Phenotype induced by Act5C-GAL4 at 28 degrees pupal lethal 
 Map Viewer
 Reference
[Please submit your publication]
Wu C, Chen Y, Wang F, Chen C, Zhang S, Li C, Li W, Wu S, Xue L.
Pelle Modulates dFoxO-Mediated Cell Death in Drosophila.
PLoS Genet. (2015) 11(10) e1005589 [ PubMed ID = 26474173 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgTCCAGCAGTTGATGGCCAACA 
 Primer Seq. 3'
aatctagaggtaccAGGGCTGGAAACGATGCGAAA 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 TCCAGCAGTT GATGGCCAAC AGAGCCTCAA CTACAACGGC CTGCCCGCCC AGCAGCAGCA 
0061 GCAATTGGCA CAGTCCACGA AAAATGTGCG AAAGAAACCC TACGTAAAGA TCACCGAACA 
0121 ACCGGCAGGA AAGGCGCTAA GGTTTCGCTA CGAGTGCGAG GGACGCTCGG CGGGATCCAT 
0181 TCCGGGCGTG AACTCTACGC CGGAGAACAA GACCTATCCG ACAATCGAAA TTGTGGGCTA 
0241 CAAGGGACGC GCCGTAGTTG TTGTCTCCTG CGTCACAAAG GATACGCCAT ATCGTCCTCA 
0301 TCCCCACAAT TTAGTTGGCA AGGAGGGCTG CAAGAAGGGC GTCTGTACAC TGGAGATCAA 
0361 CAGTGAGACA ATGCGAGCGG TGTTCAGTAA CTTGGGTATC CAGTGTGTCA AAAAGAAGGA 
0421 CATTGAGGCG GCGCTCAAGG CGCGCGAGGA GATCCGTGTG GATCCGTTTA AGACTGGCTT 
0481 TTCGCATCGT TTCCAGCCCT  
 in silico PCR Fragment
0001 TCCAGCAGTT GATGGCCAAC AGAGCCTCAA CTACAACGGC CTGCCCGCCC AGCAGCAGCA 
0061 GCAATTGGCA CAGTCCACGA AAAATGTGCG AAAGAAGCCC TACGTAAAGA TCACCGAACA 
0121 ACCGGCAGGA AAGGCGCTAA GGTTTCGCTA CGAGTGCGAG GGACGCTCGG CGGGATCCAT 
0181 TCCGGGCGTG AACTCTACGC CGGAGAACAA GACCTATCCG ACAATCGAAA TTGTGGGCTA 
0241 CAAGGGACGC GCCGTAGTTG TTGTCTCCTG CGTCACAAAG GATACGCCAT ATCGTCCTCA 
0301 TCCCCACAAT TTAGTTGGCA AGGAGGGCTG CAAGAAGGGC GTCTGTACAC TGGAGATCAA 
0361 CAGTGAGACA ATGCGAGCGG TGTTCAGTAA CTTGGGTATC CAGTGTGTCA AAAAGAAGGA 
0421 CATTGAGGCG GCGCTCAAGG CGCGCGAGGA GATCCGTGTG GATCCGTTTA AGACTGGCTT 
0481 TTCGCATCGT TTCCAGCCCT  
 Assemble Data

6667R-2.IR_full       1   TCCAGCAGTTGATGGCCAACAGAGCCTCAACTACAACGGCCTGCCCGCCCAGCAGCAGCA 60
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
6667R-2.in silico     1   TCCAGCAGTTGATGGCCAACAGAGCCTCAACTACAACGGCCTGCCCGCCCAGCAGCAGCA 60


6667R-2.IR_full       61  GCAATTGGCACAGTCCACGAAAAATGTGCGAAAGAAACCCTACGTAAAGATCACCGAACA 120
                          |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||
6667R-2.in silico     61  GCAATTGGCACAGTCCACGAAAAATGTGCGAAAGAAGCCCTACGTAAAGATCACCGAACA 120


6667R-2.IR_full       121 ACCGGCAGGAAAGGCGCTAAGGTTTCGCTACGAGTGCGAGGGACGCTCGGCGGGATCCAT 180
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
6667R-2.in silico     121 ACCGGCAGGAAAGGCGCTAAGGTTTCGCTACGAGTGCGAGGGACGCTCGGCGGGATCCAT 180


6667R-2.IR_full       181 TCCGGGCGTGAACTCTACGCCGGAGAACAAGACCTATCCGACAATCGAAATTGTGGGCTA 240
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
6667R-2.in silico     181 TCCGGGCGTGAACTCTACGCCGGAGAACAAGACCTATCCGACAATCGAAATTGTGGGCTA 240


6667R-2.IR_full       241 CAAGGGACGCGCCGTAGTTGTTGTCTCCTGCGTCACAAAGGATACGCCATATCGTCCTCA 300
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
6667R-2.in silico     241 CAAGGGACGCGCCGTAGTTGTTGTCTCCTGCGTCACAAAGGATACGCCATATCGTCCTCA 300


6667R-2.IR_full       301 TCCCCACAATTTAGTTGGCAAGGAGGGCTGCAAGAAGGGCGTCTGTACACTGGAGATCAA 360
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
6667R-2.in silico     301 TCCCCACAATTTAGTTGGCAAGGAGGGCTGCAAGAAGGGCGTCTGTACACTGGAGATCAA 360


6667R-2.IR_full       361 CAGTGAGACAATGCGAGCGGTGTTCAGTAACTTGGGTATCCAGTGTGTCAAAAAGAAGGA 420
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
6667R-2.in silico     361 CAGTGAGACAATGCGAGCGGTGTTCAGTAACTTGGGTATCCAGTGTGTCAAAAAGAAGGA 420


6667R-2.IR_full       421 CATTGAGGCGGCGCTCAAGGCGCGCGAGGAGATCCGTGTGGATCCGTTTAAGACTGGCTT 480
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
6667R-2.in silico     421 CATTGAGGCGGCGCTCAAGGCGCGCGAGGAGATCCGTGTGGATCCGTTTAAGACTGGCTT 480


6667R-2.IR_full       481 TTCGCATCGTTTCCAGCCCT 500
                          ||||||||||||||||||||
6667R-2.in silico     481 TTCGCATCGTTTCCAGCCCT 500

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  15  NM_165217.1  CG6667-RA, transcript variant A (dl), mRNA 
100   482  15  NM_165218.1  CG6667-RB, transcript variant B (dl), mRNA 
100   482  NM_165219.1  CG6667-RC, transcript variant C (dl), mRNA 
0.82   24  NM_132126.1  CG3075-RA (CG3075), mRNA 
0.82   10  NM_001043220.1  CG34127-RA (CG34127), mRNA 
0.62   17  45  NM_169386.1  CG17228-RA, transcript variant A (pros), mRNA 
0.62   NM_166871.1  CG14624-RA (CG14624), mRNA 
0.41   10  38  NM_139493.2  CG2083-RA (CG2083), mRNA 
0.2   13  27  NM_176459.1  CG17228-RD, transcript variant D (pros), mRNA 
0.2   13  27  NM_079593.3  CG17228-RC, transcript variant C (pros), mRNA 
0.2   11  45  NM_001038734.1  CG16902-RC (Hr4), mRNA 
0.2   NM_143353.1  CG12425-RA (CG12425), mRNA 
0.2   NM_170229.2  CG5099-RB, transcript variant B (msi), mRNA 
0.2   NM_079838.2  CG5099-RA, transcript variant A (msi), mRNA 
0   12  48  NM_168571.2  CG32133-RA (CG32133), mRNA 
0   20  NM_132041.2  CG15765-RA (CG15765), mRNA 
0   NM_169697.2  CG3978-RB, transcript variant B (pnr), mRNA 
0   NM_057337.2  CG3978-RA, transcript variant A (pnr), mRNA 
0   12  NM_132042.1  CG11462-RA (CG11462), mRNA 
0   28  NM_143575.2  CG12071-RA, transcript variant A (CG12071), mRNA 
0   28  NM_176592.1  CG12071-RB, transcript variant B (CG12071), mRNA 
0   16  NM_135793.2  CG16970-RA (CG16970), mRNA 
0   12  NM_169291.1  CG9381-RB, transcript variant B (mura), mRNA 
0   12  NM_169292.2  CG9381-RC, transcript variant C (mura), mRNA 
0   12  NM_141645.2  CG9381-RA, transcript variant A (mura), mRNA 
0   12  NM_079524.3  CG1030-RA, transcript variant A (Scr), mRNA 
0   12  NM_206443.1  CG1030-RB, transcript variant B (Scr), mRNA 
0   12  NM_206442.1  CG1030-RC, transcript variant C (Scr), mRNA 
0   NM_143606.1  CG15566-RA (CG15566), mRNA 
0   NM_131924.2  CG4857-RB (CG4857), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.