National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 6620R-3 
 Symbol ial  Full Name IplI-aurora-like kinase 
 CG No CG6620  Old CG No CG6620 
 Synonyms aurora B, AurB, IAL1, DmAurB, DmAuroraB, aurB, CG6620, IAL, DmAIRK2, ial, Ial 
 Accession No (Link to NCBI) NM_057988.3 
 Inserted Chr.
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
 Reference
[Please submit your publication]
Le Bras S, Rondanino C, Kriegel-Taki G, Dussert A, Le Borgne R.
Genetic identification of intracellular trafficking regulators involved in Notch-dependent binary cell fate acquisition following asymmetric cell division.
J. Cell. Sci. (2012) 125(Pt 20) 4886-901 [ PubMed ID = 22825875 ] [ RRC reference ]

Swarup S, Pradhan-Sundd T, Verheyen EM.
Genome-wide identification of phospho-regulators of Wnt signaling in Drosophila.
Development (2015) 142(8) 1502-15 [ PubMed ID = 25852200 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgATGACGCTTTCCCGCGCGAAG 
 Primer Seq. 3'
aatctagaggtaccTTGAGGGCATTCGCCACTTGG 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 ATGACGCTTT CCCGCGCGAA GcaCGCCAAC CGCAACCACC TGCCGCACCT GCTGGCCAAG 
0061 GTGCCCGAGG AGCACCAGGA GCCGATCAAG AATATGTGCC TCAAGATGAT GTCCCACGAC 
0121 GCATACGGAC AGCCATACGA TTGGAGTCCC CGGGACTTTG AGATGGGCGC CCACTTGGGA 
0181 CGCGGCAAAT TTGGACGTGT CTANCTTGGC GCNGGGAGCG CCACTCGCCA CTATCTGGTG 
0241 GCCATGAAGG TGATGTTCAA AGAGGAGCTG CGCAAGGGCT GCGTGCAGCG TCAGGTTCTA 
0301 CGCGAGATCG AGATCCAGTC GCGACTGAAG CACCCGCACA TCCTGCGCCT GCTCACTTGG 
0361 TTCCACGACG AGAGCCGCAT ATATCTGGCC CTGGAAATTG CGTCCGAGGG CGAGCTGTTC 
0421 AAGCACCTGC GTGGCGCACC CAATCATCGA TTCGATGAAC CGCGGTCTGC GAAGTACACC 
0481 TACCAAGTgG CGAATGCCCT CAA 
 in silico PCR Fragment
0001 ATGACGCTTT CCCGCGCGAA GCACGCCAAC CGCAACCACC TGCCGCACCT GCTGGCCAAG 
0061 GTGCCCGAGG AGCACCAGGA GCCGATCAAG AATATGTGCC TCAAGATGAT GTCCCACGAC 
0121 GCATACGGAC AGCCATACGA TTGGAGTCCC CGGGACTTTG AGATGGGCGC CCACTTGGGA 
0181 CGCGGCAAAT TTGGACGTGT CTA-CTTGGC GC-GGGAGCG CCACTCG-CA CTATCTGGTG 
0241 GCCATGAAGG TGATGTTCAA AGAGGAGCTG CGCAAGGGCT GCGTGCAGCG TCAGGTTCTA 
0301 CGCGAGATCG AGATCCAGTC GCGACTGAAG CACCCGCACA TCCTGCGCCT GCTCACTTGG 
0361 TTCCACGACG AGAGCCGCAT CTATCTGGCC CTGGAAATTG CGTCCGAGGG CGAGCTGTTC 
0421 AAGCACCTGC GTGGCGCACC CAATCATCGA TTCGATGAAC CGCGGTCTGC GAAGTACACC 
0481 TACCAAGTGG CGAATGCCCT CAA 
 Assemble Data

6620R-3.IR_full       1   ATGACGCTTTCCCGCGCGAAGCACGCCAACCGCAACCACCTGCCGCACCTGCTGGCCAAG 60
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
6620R-3.in silico     1   ATGACGCTTTCCCGCGCGAAGCACGCCAACCGCAACCACCTGCCGCACCTGCTGGCCAAG 60


6620R-3.IR_full       61  GTGCCCGAGGAGCACCAGGAGCCGATCAAGAATATGTGCCTCAAGATGATGTCCCACGAC 120
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
6620R-3.in silico     61  GTGCCCGAGGAGCACCAGGAGCCGATCAAGAATATGTGCCTCAAGATGATGTCCCACGAC 120


6620R-3.IR_full       121 GCATACGGACAGCCATACGATTGGAGTCCCCGGGACTTTGAGATGGGCGCCCACTTGGGA 180
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
6620R-3.in silico     121 GCATACGGACAGCCATACGATTGGAGTCCCCGGGACTTTGAGATGGGCGCCCACTTGGGA 180


6620R-3.IR_full       181 CGCGGCAAATTTGGACGTGTCTANCTTGGCGCNGGGAGCGCCACTCGCCACTATCTGGTG 240
                          ||||||||||||||||||||||| |||||||| |||||||||||||| ||||||||||||
6620R-3.in silico     181 CGCGGCAAATTTGGACGTGTCTA-CTTGGCGC-GGGAGCGCCACTCG-CACTATCTGGTG 240


6620R-3.IR_full       241 GCCATGAAGGTGATGTTCAAAGAGGAGCTGCGCAAGGGCTGCGTGCAGCGTCAGGTTCTA 300
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
6620R-3.in silico     241 GCCATGAAGGTGATGTTCAAAGAGGAGCTGCGCAAGGGCTGCGTGCAGCGTCAGGTTCTA 300


6620R-3.IR_full       301 CGCGAGATCGAGATCCAGTCGCGACTGAAGCACCCGCACATCCTGCGCCTGCTCACTTGG 360
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
6620R-3.in silico     301 CGCGAGATCGAGATCCAGTCGCGACTGAAGCACCCGCACATCCTGCGCCTGCTCACTTGG 360


6620R-3.IR_full       361 TTCCACGACGAGAGCCGCATATATCTGGCCCTGGAAATTGCGTCCGAGGGCGAGCTGTTC 420
                          |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||
6620R-3.in silico     361 TTCCACGACGAGAGCCGCATCTATCTGGCCCTGGAAATTGCGTCCGAGGGCGAGCTGTTC 420


6620R-3.IR_full       421 AAGCACCTGCGTGGCGCACCCAATCATCGATTCGATGAACCGCGGTCTGCGAAGTACACC 480
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
6620R-3.in silico     421 AAGCACCTGCGTGGCGCACCCAATCATCGATTCGATGAACCGCGGTCTGCGAAGTACACC 480


6620R-3.IR_full       481 TACCAAGTGGCGAATGCCCTCAA 503
                          |||||||||||||||||||||||
6620R-3.in silico     481 TACCAAGTGGCGAATGCCCTCAA 503

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_057988.3  CG6620-RA (ial), mRNA 
0.82   NM_132479.2  CG1597-RA (CG1597), mRNA 
0   NM_142495.1  CG14299-RA, transcript variant A (CG14299), mRNA 
0   NM_001014640.1  CG14299-RB, transcript variant B (CG14299), mRNA 
0   NM_078922.2  CG4486-RA (Cyp9b2), mRNA 
0   NM_166420.1  CG30293-RA (CG30293), mRNA 
0   NM_138005.1  CG13562-RA (CG13562), mRNA 
0   NM_137633.1  CG16739-RA (CG16739), mRNA 
0   NM_167072.1  CG3861-RB, transcript variant B (l(1)G0030), mRNA 
0   NM_132091.2  CG3861-RA, transcript variant A (l(1)G0030), mRNA 
0   NM_078520.2  CG2212-RA, transcript variant A (sws), mRNA 
0   NM_001014545.1  CG33519-RB (Unc-89), mRNA 
0   NM_142112.2  CG8279-RA (Pde6), mRNA 
0   NM_169371.1  CG6584-RD, transcript variant D (SelR), mRNA 
0   NM_206473.1  CG6584-RF, transcript variant F (SelR), mRNA 
0   NM_141773.2  CG6584-RA, transcript variant A (SelR), mRNA 
0   NM_169370.2  CG6584-RB, transcript variant B (SelR), mRNA 
0   NM_169369.1  CG6584-RE, transcript variant E (SelR), mRNA 
0   NM_169368.1  CG6584-RC, transcript variant C (SelR), mRNA 
0   NM_140297.2  CG9760-RB (CG9760), mRNA 
0   NM_079710.2  CG6570-RA (lbl), mRNA 
0   NM_139802.2  CG32392-RB, transcript variant B (CG32392), mRNA 
0   NM_168180.1  CG32392-RA, transcript variant A (CG32392), mRNA 
0   NM_168468.1  CG32091-RB (CG32091), mRNA 
0   NM_140760.2  CG7430-RA (CG7430), mRNA 
0   NM_134984.2  CG3652-RA (CG3652), mRNA 
0   NM_078722.2  CG17941-RA (ds), mRNA 
0   NM_057545.3  CG14513-RA (yemalpha), mRNA 
0   NM_139615.2  CG15006-RA (CG15006), mRNA 
0   NM_078605.1  CG6211-RA (gce), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.