National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 6620R-2 
 Symbol ial  Full Name IplI-aurora-like kinase 
 CG No CG6620  Old CG No CG6620 
 Synonyms aurora B, AurB, IAL1, DmAurB, DmAuroraB, aurB, CG6620, IAL, DmAIRK2, ial, Ial 
 Accession No (Link to NCBI) NM_057988.3 
 Inserted Chr. ll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
[Please submit your publication]
Kitazawa D, Matsuo T, Kaizuka K, Miyauchi C, Hayashi D, Inoue YH.
Orbit/CLASP is required for myosin accumulation at the cleavage furrow in Drosophila male meiosis.
PLoS ONE (2014) 9(5) e93669 [ PubMed ID = 24850412 ] [ RRC reference ]

Le Bras S, Rondanino C, Kriegel-Taki G, Dussert A, Le Borgne R.
Genetic identification of intracellular trafficking regulators involved in Notch-dependent binary cell fate acquisition following asymmetric cell division.
J. Cell. Sci. (2012) 125(Pt 20) 4886-901 [ PubMed ID = 22825875 ] [ RRC reference ]  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
 Primer Seq. 3'
 Predicted Fragment Size
 IR fragment full Seq
 in silico PCR Fragment
 Assemble Data

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     1   ATGACGCTTTCCCGCGCGAAGCACGCCAACCGCAACCACCTGCCGCACCTGCTGGCCAAG 60

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     61  GTGCCCGAGGAGCACCAGGAGCCGATCAAGAATATGTGCCTCAAGATGATGTCCCACGAC 120

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     121 GCATACGGACAGCCATACGATTGGAGTCCCCGGGACTTTGAGATGGGCGCCCACTTGGGA 180

                          ||||||||||||||||||||||| |||||||| |||||||||||||| |||||||||||| silico     181 CGCGGCAAATTTGGACGTGTCTA-CTTGGCGC-GGGAGCGCCACTCG-CACTATCTGGTG 240

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     241 GCCATGAAGGTGATGTTCAAAGAGGAGCTGCGCAAGGGCTGCGTGCAGCGTCAGGTTCTA 300

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     301 CGCGAGATCGAGATCCAGTCGCGACTGAAGCACCCGCACATCCTGCGCCTGCTCACTTGG 360

                          |||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| silico     361 TTCCACGACGAGAGCCGCATCTATCTGGCCCTGGAAATTGCGTCCGAGGGCGAGCTGTTC 420

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     421 AAGCACCTGCGTGGCGCACCCAATCATCGATTCGATGAACCGCGGTCTGCGAAGTACACC 480

6620R-2.IR_full       481 TACCAAGTGGCGAATGCCCTCAA 503
                          ||||||||||||||||||||||| silico     481 TACCAAGTGGCGAATGCCCTCAA 503

 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_057988.3  CG6620-RA (ial), mRNA 
0.82   NM_132479.2  CG1597-RA (CG1597), mRNA 
0   NM_142495.1  CG14299-RA, transcript variant A (CG14299), mRNA 
0   NM_001014640.1  CG14299-RB, transcript variant B (CG14299), mRNA 
0   NM_078922.2  CG4486-RA (Cyp9b2), mRNA 
0   NM_166420.1  CG30293-RA (CG30293), mRNA 
0   NM_138005.1  CG13562-RA (CG13562), mRNA 
0   NM_137633.1  CG16739-RA (CG16739), mRNA 
0   NM_167072.1  CG3861-RB, transcript variant B (l(1)G0030), mRNA 
0   NM_132091.2  CG3861-RA, transcript variant A (l(1)G0030), mRNA 
0   NM_078520.2  CG2212-RA, transcript variant A (sws), mRNA 
0   NM_001014545.1  CG33519-RB (Unc-89), mRNA 
0   NM_142112.2  CG8279-RA (Pde6), mRNA 
0   NM_169371.1  CG6584-RD, transcript variant D (SelR), mRNA 
0   NM_206473.1  CG6584-RF, transcript variant F (SelR), mRNA 
0   NM_141773.2  CG6584-RA, transcript variant A (SelR), mRNA 
0   NM_169370.2  CG6584-RB, transcript variant B (SelR), mRNA 
0   NM_169369.1  CG6584-RE, transcript variant E (SelR), mRNA 
0   NM_169368.1  CG6584-RC, transcript variant C (SelR), mRNA 
0   NM_140297.2  CG9760-RB (CG9760), mRNA 
0   NM_079710.2  CG6570-RA (lbl), mRNA 
0   NM_139802.2  CG32392-RB, transcript variant B (CG32392), mRNA 
0   NM_168180.1  CG32392-RA, transcript variant A (CG32392), mRNA 
0   NM_168468.1  CG32091-RB (CG32091), mRNA 
0   NM_140760.2  CG7430-RA (CG7430), mRNA 
0   NM_134984.2  CG3652-RA (CG3652), mRNA 
0   NM_078722.2  CG17941-RA (ds), mRNA 
0   NM_057545.3  CG14513-RA (yemalpha), mRNA 
0   NM_139615.2  CG15006-RA (CG15006), mRNA 
0   NM_078605.1  CG6211-RA (gce), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.