National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 6538R-1 
 Symbol TfIIFbeta  Full Name Transcription factor TFIIFbeta 
 CG No CG6538  Old CG No CG6538 
 Synonyms RAP30, TFIIF, F[[S]], CG6538, dTFIIF30, TfIIFbeta, TFIIFbeta, l(3)j3C1, TfIIF 
 Accession No (Link to NCBI) NM_079581.2 
 Inserted Chr. ll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
 Reference
[Please submit your publication]
Saj A, Arziman Z, Stempfle D, van Belle W, Sauder U, Horn T, D├╝rrenberger M, Paro R, Boutros M, Merdes G.
A combined ex vivo and in vivo RNAi screen for notch regulators in Drosophila reveals an extensive notch interaction network.
Dev. Cell (2010) 18(5) 862-76 [ PubMed ID = 20493818 ] [ RRC reference ]

Nitta Y, Yamazaki D, Sugie A, Hiroi M, Tabata T.
DISCO Interacting Protein 2 regulates axonal bifurcation and guidance of Drosophila mushroom body neurons.
Dev. Biol. (2016) 421(2) 233-244 [ PubMed ID = 27908785 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgTCCCGAGGAGAAAATACCCAC 
 Primer Seq. 3'
aatctagaggtaccGTAATCGCAGACATCCTTGAG 
 Predicted Fragment Size
499 
 IR fragment full Seq
0001 TCCCGAGGAG AAAATACCCA CCGAGCACAT CCTGGACGTG TCGCAGGTCA CCAAGCAGAC 
0061 GCTCGGCGTA TTCTCGCACA TGGCACCGTC CGATGGCAAG GAGAACTCGA CTACCTCGGC 
0121 GGCACAGCCG GATAACGAAA AGTTGTATAT GGAGGGCAGG ATTGTGCAAA AGCTAGAGTG 
0181 CCGACCCATC GCCGACAACT GCTACATGAA ACTAAAGCTG GAGTCCATAC GCAAGGCATC 
0241 GGAACCACAG CGACGTGTGC AGCCTATCGA CAAAATCGTG CAGAACTTTA AGCCTGTGAA 
0301 AGACCATGCA CACAACATTG AATATCGGGA GCGAAAGAAG GCCGAGGGCA AGAAGGCGCG 
0361 CGACGACAAG AATGCCGTGA TGGATATGCT CTTTCACGCA TTCGAGAAGC ATCAATACTA 
0421 TAACATCAAG GATCTGGTCA AGATCACCAA CCAGCCGATT AGCTACCTGA AGGAGATTCT 
0481 CAAGGATGTC TGCGATTAC 
 in silico PCR Fragment
0001 TCCCGAGGAG AAAATACCCA CCGAGCACAT CCTGGACGTG TCGCAGGTCA CCAAGCAGAC 
0061 GCTCGGCGTA TTCTCGCACA TGGCACCGTC CGATGGCAAG GAGAACTCGA CTACCTCGGC 
0121 GGCACAGCCG GATAACGAAA AGTTGTATAT GGAGGGCAGG ATTGTGCAAA AGCTAGAGTG 
0181 CCGACCCATC GCCGACAACT GCTACATGAA ACTAAAGCTG GAGTCCATAC GCAAGGCATC 
0241 GGAACCACAG CGACGTGTGC AGCCTATCGA CAAAATCGTG CAGAACTTTA AGCCTGTAAA 
0301 AGACCACGCA CACAACATTG AATATCGGGA GCGAAAGAAG GCCGAGGGCA AGAAGGCGCG 
0361 CGACGACAAG AATGCCGTGA TGGATATGCT CTTCCACGCA TTCGAGAAGC ATCAATACTA 
0421 TAACATCAAG GATCTGGTCA AGATCACCAA CCAGCCGATT AGCTACCTGA AGGAGATTCT 
0481 CAAGGATGTC TGCGATTAC 
 Assemble Data

6538R-1.IR_full       1   TCCCGAGGAGAAAATACCCACCGAGCACATCCTGGACGTGTCGCAGGTCACCAAGCAGAC 60
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
6538R-1.in silico     1   TCCCGAGGAGAAAATACCCACCGAGCACATCCTGGACGTGTCGCAGGTCACCAAGCAGAC 60


6538R-1.IR_full       61  GCTCGGCGTATTCTCGCACATGGCACCGTCCGATGGCAAGGAGAACTCGACTACCTCGGC 120
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
6538R-1.in silico     61  GCTCGGCGTATTCTCGCACATGGCACCGTCCGATGGCAAGGAGAACTCGACTACCTCGGC 120


6538R-1.IR_full       121 GGCACAGCCGGATAACGAAAAGTTGTATATGGAGGGCAGGATTGTGCAAAAGCTAGAGTG 180
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
6538R-1.in silico     121 GGCACAGCCGGATAACGAAAAGTTGTATATGGAGGGCAGGATTGTGCAAAAGCTAGAGTG 180


6538R-1.IR_full       181 CCGACCCATCGCCGACAACTGCTACATGAAACTAAAGCTGGAGTCCATACGCAAGGCATC 240
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
6538R-1.in silico     181 CCGACCCATCGCCGACAACTGCTACATGAAACTAAAGCTGGAGTCCATACGCAAGGCATC 240


6538R-1.IR_full       241 GGAACCACAGCGACGTGTGCAGCCTATCGACAAAATCGTGCAGAACTTTAAGCCTGTGAA 300
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||
6538R-1.in silico     241 GGAACCACAGCGACGTGTGCAGCCTATCGACAAAATCGTGCAGAACTTTAAGCCTGTAAA 300


6538R-1.IR_full       301 AGACCATGCACACAACATTGAATATCGGGAGCGAAAGAAGGCCGAGGGCAAGAAGGCGCG 360
                          |||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||
6538R-1.in silico     301 AGACCACGCACACAACATTGAATATCGGGAGCGAAAGAAGGCCGAGGGCAAGAAGGCGCG 360


6538R-1.IR_full       361 CGACGACAAGAATGCCGTGATGGATATGCTCTTTCACGCATTCGAGAAGCATCAATACTA 420
                          ||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||
6538R-1.in silico     361 CGACGACAAGAATGCCGTGATGGATATGCTCTTCCACGCATTCGAGAAGCATCAATACTA 420


6538R-1.IR_full       421 TAACATCAAGGATCTGGTCAAGATCACCAACCAGCCGATTAGCTACCTGAAGGAGATTCT 480
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
6538R-1.in silico     421 TAACATCAAGGATCTGGTCAAGATCACCAACCAGCCGATTAGCTACCTGAAGGAGATTCT 480


6538R-1.IR_full       481 CAAGGATGTCTGCGATTAC 499
                          |||||||||||||||||||
6538R-1.in silico     481 CAAGGATGTCTGCGATTAC 499

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   481  NM_079581.2  CG6538-RA (TfIIFbeta), mRNA 
0.41   NM_080013.2  CG6050-RA (EfTuM), mRNA 
0   NM_167895.1  CG12099-RA, transcript variant A (CG12099), mRNA 
0   NM_139366.2  CG12099-RB, transcript variant B (CG12099), mRNA 
0   NM_168715.1  CG7930-RB, transcript variant B (TpnC73F), mRNA 
0   NM_057374.2  CG3722-RA (shg), mRNA 
0   NM_079398.2  CG7930-RA, transcript variant A (TpnC73F), mRNA 
0   NM_057620.4  CG9073-RA (TpnC47D), mRNA 
0   NM_001031918.1  CG1410-RA, transcript variant A (waw), mRNA 
0   NM_001031917.1  CG1414-RB, transcript variant B (bbx), mRNA 
0   NM_140561.3  CG5931-RA (CG5931), mRNA 
0   NM_138200.2  CG12030-RA (CG12030), mRNA 
0   NM_137947.2  CG3530-RB, transcript variant B (CG3530), mRNA 
0   NM_166603.1  CG3530-RA, transcript variant A (CG3530), mRNA 
0   NM_079684.3  CG4510-RA (Surf6), mRNA 
0   NM_134744.1  CG14342-RA (CG14342), mRNA 
0   NM_131987.2  CG4202-RA (Sas10), mRNA 
0   NM_141657.2  CG8273-RA (CG8273), mRNA 
0   NM_140997.2  CG11399-RB (CG11399), mRNA 
0   NM_142986.2  CG5720-RA (CG5720), mRNA 
0   NM_137007.3  CG12765-RA (CG12765), mRNA 
0   NM_176556.1  CG33106-RA, transcript variant A (mask), mRNA 
0   NM_176557.1  CG33106-RB, transcript variant B (mask), mRNA 
0   NM_138097.2  CG3548-RA (CG3548), mRNA 
0   NM_001031924.1  CG9130-RB, transcript variant B (CG9130), mRNA 
0   NM_001031925.1  CG9130-RA, transcript variant A (CG9130), mRNA 
0   NM_001031921.1  CG9133-RD, transcript variant D (CG9133), mRNA 
0   NM_001031923.1  CG9133-RC, transcript variant C (CG9133), mRNA 
0   NM_001031922.1  CG9133-RB, transcript variant B (CG9133), mRNA 
0   NM_132792.2  CG6227-RA (CG6227), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.