National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 6534R-1 
 Symbol slou  Full Name slouch 
 CG No CG6534  Old CG No CG6534 
 Synonyms S59, s59, slou/NK1, NK1, S-59, S59/NK-1, NK-1, NK1/S59, Nk1, prd9, CG6534, slou 
 Accession No (Link to NCBI) NM_057309.2 
 Inserted Chr. ll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees viable 
 Map Viewer
 Reference
[Please submit your publication]
Bataillé L, Delon I, Da Ponte JP, Brown NH, Jagla K.
Downstream of identity genes: muscle-type-specific regulation of the fusion process.
Dev. Cell (2010) 19(2) 317-28 [ PubMed ID = 20708593 ] [ RRC reference ]

Nitta Y, Yamazaki D, Sugie A, Hiroi M, Tabata T.
DISCO Interacting Protein 2 regulates axonal bifurcation and guidance of Drosophila mushroom body neurons.
Dev. Biol. (2017) 421(2) 233-244 [ PubMed ID = 27908785 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgACTCCGCCAGCGGCCAAGATA 
 Primer Seq. 3'
aatctagaggtaccGGATGCGGATGCTGATGCGAA 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 ACTCCGCCAG CGGCCAAGAT ACCCAAGTTC ATCATCAGCG CCAATGGCGC AGCGGTGGCG 
0061 GAGAAAACAG GAGCAGGAGC TGAGGTACTC CCTCGAACGG CTCAAGCAGA TGAGCAGTGA 
0121 ATCGGGCAGC TTGCTCAGCC GCTTGAGCCC CTTGCAGGAG GACTCCCAGG ATAAGGAGAA 
0181 GCCCAATCAC AACAACAATA ACAGTCTAAC TAATCACAAT GCAAACAGCA ATACACGTCG 
0241 CTCGCAATCC CCTCCAGCAT CGGTGGGATC CGTAAGCTTC TCCTCGCCAG CCCAGCAGCG 
0301 AAAGCTCCTG GAACTGAATG CTGTGCGCCA CTTGGCAAGG cCGGAGCCAC TGCAGCATCC 
0361 TCATGCGGCC CTGCTGCAGC AGCATCCCCA CTTGCTGCAG AATCCGCAGT TCCTGGCCGC 
0421 CGCCCAGCAG CACATGCACC ATCATCAGCA TCAGCATCAC CAGCATCCCG CACATCCGCA 
0481 TTCGCATCAG CATCNCGCAT CC 
 in silico PCR Fragment
0001 ACTCCGCCAG CGGCCAAGAT ACCCAAGTTC ATCATCAGCG CCAATGGCGC AGCGGTGGCG 
0061 G-GAAAACAG GAGCAGGAGC TGAGGTACTC CCTCGAACGG CTCAAGCAGA TGAGCAGTGA 
0121 ATCGGGCAGC TTGCTCAGCC GCTTGAGCCC CTTGCAGGAG GACTCCCAGG ATAAGGAGAA 
0181 GCCCAATCAC AACAACAATA ACAGTCTAAC TAATCACAAT GCAAACAGCA ATACACGTCG 
0241 CTCGCAATCC CCTCCAGCAT CGGTGGGATC CGTAAGCTTC TCCTCGCCAG CCCAGCAGCG 
0301 AAAGCTCCTG GAACTGAATG CTGTGCGCCA CTTGGCAAGG CCGGAGCCAC TGCAGCATCC 
0361 TCATGCGGCC CTGCTGCAGC AGCATCCCCA CTTGCTGCAG AATCCGCAGT TCCTGGCCGC 
0421 CGCCCAGCAG CACATGCACC ATCATCAGCA TCAGCATCAC CAGCATCCCG CACATCCGCA 
0481 TTCGCATCAG CATC-CGCAT CC 
 Assemble Data

6534R-1.IR_full       1   ACTCCGCCAGCGGCCAAGATACCCAAGTTCATCATCAGCGCCAATGGCGCAGCGGTGGCG 60
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
6534R-1.in silico     1   ACTCCGCCAGCGGCCAAGATACCCAAGTTCATCATCAGCGCCAATGGCGCAGCGGTGGCG 60


6534R-1.IR_full       61  GAGAAAACAGGAGCAGGAGCTGAGGTACTCCCTCGAACGGCTCAAGCAGATGAGCAGTGA 120
                          | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
6534R-1.in silico     61  G-GAAAACAGGAGCAGGAGCTGAGGTACTCCCTCGAACGGCTCAAGCAGATGAGCAGTGA 120


6534R-1.IR_full       121 ATCGGGCAGCTTGCTCAGCCGCTTGAGCCCCTTGCAGGAGGACTCCCAGGATAAGGAGAA 180
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
6534R-1.in silico     121 ATCGGGCAGCTTGCTCAGCCGCTTGAGCCCCTTGCAGGAGGACTCCCAGGATAAGGAGAA 180


6534R-1.IR_full       181 GCCCAATCACAACAACAATAACAGTCTAACTAATCACAATGCAAACAGCAATACACGTCG 240
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
6534R-1.in silico     181 GCCCAATCACAACAACAATAACAGTCTAACTAATCACAATGCAAACAGCAATACACGTCG 240


6534R-1.IR_full       241 CTCGCAATCCCCTCCAGCATCGGTGGGATCCGTAAGCTTCTCCTCGCCAGCCCAGCAGCG 300
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
6534R-1.in silico     241 CTCGCAATCCCCTCCAGCATCGGTGGGATCCGTAAGCTTCTCCTCGCCAGCCCAGCAGCG 300


6534R-1.IR_full       301 AAAGCTCCTGGAACTGAATGCTGTGCGCCACTTGGCAAGGCCGGAGCCACTGCAGCATCC 360
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
6534R-1.in silico     301 AAAGCTCCTGGAACTGAATGCTGTGCGCCACTTGGCAAGGCCGGAGCCACTGCAGCATCC 360


6534R-1.IR_full       361 TCATGCGGCCCTGCTGCAGCAGCATCCCCACTTGCTGCAGAATCCGCAGTTCCTGGCCGC 420
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
6534R-1.in silico     361 TCATGCGGCCCTGCTGCAGCAGCATCCCCACTTGCTGCAGAATCCGCAGTTCCTGGCCGC 420


6534R-1.IR_full       421 CGCCCAGCAGCACATGCACCATCATCAGCATCAGCATCACCAGCATCCCGCACATCCGCA 480
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
6534R-1.in silico     421 CGCCCAGCAGCACATGCACCATCATCAGCATCAGCATCACCAGCATCCCGCACATCCGCA 480


6534R-1.IR_full       481 TTCGCATCAGCATCNCGCATCC 502
                          |||||||||||||| |||||||
6534R-1.in silico     481 TTCGCATCAGCATC-CGCATCC 502

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  46  NM_057309.2  CG6534-RA (slou), mRNA 
0.62   NM_080036.1  CG17100-RA (CG17100), mRNA 
0.41   19  NM_079825.1  CG15504-RA (dmrt99B), mRNA 
0.2   32  NM_130616.2  CG4290-RA (CG4290), mRNA 
0.2   38  NM_170229.2  CG5099-RB, transcript variant B (msi), mRNA 
0.2   37  NM_079838.2  CG5099-RA, transcript variant A (msi), mRNA 
0.2   13  NM_078937.3  CG2411-RA (ptc), mRNA 
0.2   NM_165656.1  CG30345-RA (CG30345), mRNA 
0   13  19  37  NM_134525.1  CG9571-RA (CG9571), mRNA 
0   11  18  79  NM_058124.2  CG5772-RA (Sur), mRNA 
0   26  71  NM_079409.2  CG8127-RA, transcript variant A (Eip75B), mRNA 
0   14  73  NM_139420.1  CG12361-RA (CG12361), mRNA 
0   27  74  NM_164726.1  CG31908-RA, transcript variant A (CG31908), mRNA 
0   27  74  NM_164727.1  CG31908-RB, transcript variant B (CG31908), mRNA 
0   16  63  NM_001014727.1  CG12154-RB, transcript variant B (oc), mRNA 
0   16  63  NM_078536.3  CG12154-RA, transcript variant A (oc), mRNA 
0   12  46  NM_205901.1  CG3304-RC, transcript variant C (CG3304), mRNA 
0   NM_176246.1  CG33143-RC, transcript variant C (CG33143), mRNA 
0   NM_079699.2  CG5685-RA, transcript variant A (Calx), mRNA 
0   NM_169940.1  CG5685-RB, transcript variant B (Calx), mRNA 
0   NM_169941.1  CG5685-RC, transcript variant C (Calx), mRNA 
0   37  286  NM_080536.2  CG4013-RA, transcript variant A (Smr), mRNA 
0   37  286  NM_167334.1  CG4013-RB, transcript variant B (Smr), mRNA 
0   37  286  NM_167335.1  CG4013-RC, transcript variant C (Smr), mRNA 
0   25  70  NM_143194.1  CG14540-RA (CG14540), mRNA 
0   19  51  NM_144119.2  CG33466-RA (Fs), mRNA 
0   11  48  NM_001038743.1  CG33980-RA (CG33980), mRNA 
0   38  NM_136636.3  CG13739-RA (CG13739), mRNA 
0   19  NM_132346.1  CG3003-RB (CG3003), mRNA 
0   NM_078571.2  CG1705-RA (Rst(1)JH), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.