National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 6502R-3 
 Symbol E(z)  Full Name Enhancer of zeste 
 CG No CG6502  Old CG No CG6502 
 Synonyms CG6502, E(Z), EZ, E(z)1, Ez, E[z], Su(z)301, pco, l(3)67Fa, l(3)1902, pco/E(z), l(3)ds12, l(3)SG17, l(3)B12, E(z) 
 Accession No (Link to NCBI) NM_079297.2 
 Inserted Chr. lll 
 Insertional Mutation  semi-lethal 
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
 Reference
[Please submit your publication]
Shih HT, Chen WY, Liu KY, Shih ZS, Chen YJ, Hsieh PC, Kuo KL, Huang KH, Hsu PH, Liu YW, Chan SP, Lee HH, Tsai YC, Wu JT.
dBRWD3 Regulates Tissue Overgrowth and Ectopic Gene Expression Caused by Polycomb Group Mutations.
PLoS Genet. (2016) 12(9) e1006262 [ PubMed ID = 27588417 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgAAAAGGTGCCCATTTGCGTGA 
 Primer Seq. 3'
aatctagaggtaccTTCTTCCACATCGGGCTTAAC 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 AAAAGGTGCC CATTTGCGTG ATCAACGcGG TCACTCCCAT ACCCACCATG TACACGTGGG 
0061 CACCAACACA GCAGAACTTC ATGGTGGAGG ATGAGACGGT GCTGCACAAT ATACCCTATA 
0121 TGGGCGACGA GGTCCTCGAT AAGGATGGCA AGTTCATAGA GGAACTGATC AAAAACTACG 
0181 ATGGCAAGGT CCACGGCGAC AAGGATCCCT CGTTCATGGA CGATGCCATC TTCGTAGAAC 
0241 TGGTGCACGC CCTCATGCGC TCCTATAGCA AGGAGCTGGA GGAAGCCGCT CCGAGTACTT 
0301 CGACTGCCAT TAAAACANAG ACGTTGGCGA AATCAAAACA GGGCGAAGAT GATGGGGTAG 
0361 TTGATGTTGA CGCAGATGGT GAATCTCCCA TGAAGCTTGA GAAAACCGAC AGCAAAGGGG 
0421 ATCTGNCTGA AGTTGAGAAG AAGGAAACTG AAGAACCGCT GGAGACTGAA GATGCGGATG 
0481 TTAAGCCCGA TGTGGAAGAA  
 in silico PCR Fragment
0001 AAAAGGTGCC CATTTGCGTG ATCAACGCGG TCACTCCCAT ACCCACCATG TACACGTGGG 
0061 CACCAACACA GCAGAACTTC ATGGTGGAGG ATGAGACGGT GCTGCACAAT ATACCCTATA 
0121 TGGGCGACGA GGTCCTCGAT AAGGATGGCA AGTTCATAGA GGAACTGATC AAAAACTACG 
0181 ATGGCAAGGT TCACGGCGAC AAGGATCCCT CGTTCATGGA CGATGCCATC TTCGTAGAAC 
0241 TGGTGCACGC CCTTATGCGC TCCTACAGCA AGGAACTGGA GGAAGCCGCT CCGGGTACAG 
0301 CGACTGCCAT TAAAACAGAG ACGTTGGCGA AATCAAAACA GGGCGAAGAT GATGGGGTAG 
0361 TTGATGTTGA CGCAGATGGT GAATCTCCCA TGAAGCTTGA GAAAACCGAC AGCAAAGGGG 
0421 ATCTGACTGA AGTTGAGAAG AAGGAAACTG AAGAACCGCT GGAGACTGAA GATGCGGATG 
0481 TTAAGCCCGA TGTGGAAGAA  
 Assemble Data

6502R-3.IR_full       1   AAAAGGTGCCCATTTGCGTGATCAACGCGGTCACTCCCATACCCACCATGTACACGTGGG 60
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
6502R-3.in silico     1   AAAAGGTGCCCATTTGCGTGATCAACGCGGTCACTCCCATACCCACCATGTACACGTGGG 60


6502R-3.IR_full       61  CACCAACACAGCAGAACTTCATGGTGGAGGATGAGACGGTGCTGCACAATATACCCTATA 120
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
6502R-3.in silico     61  CACCAACACAGCAGAACTTCATGGTGGAGGATGAGACGGTGCTGCACAATATACCCTATA 120


6502R-3.IR_full       121 TGGGCGACGAGGTCCTCGATAAGGATGGCAAGTTCATAGAGGAACTGATCAAAAACTACG 180
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
6502R-3.in silico     121 TGGGCGACGAGGTCCTCGATAAGGATGGCAAGTTCATAGAGGAACTGATCAAAAACTACG 180


6502R-3.IR_full       181 ATGGCAAGGTCCACGGCGACAAGGATCCCTCGTTCATGGACGATGCCATCTTCGTAGAAC 240
                          |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||
6502R-3.in silico     181 ATGGCAAGGTTCACGGCGACAAGGATCCCTCGTTCATGGACGATGCCATCTTCGTAGAAC 240


6502R-3.IR_full       241 TGGTGCACGCCCTCATGCGCTCCTATAGCAAGGAGCTGGAGGAAGCCGCTCCGAGTACTT 300
                          ||||||||||||| ||||||||||| |||||||| |||||||||||||||||| ||||  
6502R-3.in silico     241 TGGTGCACGCCCTTATGCGCTCCTACAGCAAGGAACTGGAGGAAGCCGCTCCGGGTACAG 300


6502R-3.IR_full       301 CGACTGCCATTAAAACANAGACGTTGGCGAAATCAAAACAGGGCGAAGATGATGGGGTAG 360
                          ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||
6502R-3.in silico     301 CGACTGCCATTAAAACAGAGACGTTGGCGAAATCAAAACAGGGCGAAGATGATGGGGTAG 360


6502R-3.IR_full       361 TTGATGTTGACGCAGATGGTGAATCTCCCATGAAGCTTGAGAAAACCGACAGCAAAGGGG 420
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
6502R-3.in silico     361 TTGATGTTGACGCAGATGGTGAATCTCCCATGAAGCTTGAGAAAACCGACAGCAAAGGGG 420


6502R-3.IR_full       421 ATCTGNCTGAAGTTGAGAAGAAGGAAACTGAAGAACCGCTGGAGACTGAAGATGCGGATG 480
                          ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||
6502R-3.in silico     421 ATCTGACTGAAGTTGAGAAGAAGGAAACTGAAGAACCGCTGGAGACTGAAGATGCGGATG 480


6502R-3.IR_full       481 TTAAGCCCGATGTGGAAGAA 500
                          ||||||||||||||||||||
6502R-3.in silico     481 TTAAGCCCGATGTGGAAGAA 500

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_079297.2  CG6502-RA (E(z)), mRNA 
0   NM_133138.1  CG7884-RA (CG7884), mRNA 
0   NM_132267.4  CG12109-RB (Caf1-180), mRNA 
0   NM_165490.1  CG3427-RA (Epac), mRNA 
0   NM_169450.1  CG14741-RA (CG14741), mRNA 
0   NM_079919.2  CG5700-RB (prc), mRNA 
0   NM_166186.2  CG18471-RA (gprs), mRNA 
0   NM_139582.1  CG12766-RA (CG12766), mRNA 
0   NM_143367.2  CG10011-RA (CG10011), mRNA 
0   NM_166300.1  CG5473-RB, transcript variant B (SP2637), mRNA 
0   NM_137511.2  CG5473-RA, transcript variant A (SP2637), mRNA 
0   NM_139572.1  CG10855-RA (CG10855), mRNA 
0   NM_132320.2  CG12124-RA (CG12124), mRNA 
0   NM_078559.2  CG18085-RA (sev), mRNA 
0   NM_079663.2  CG5826-RA (Prx5037), mRNA 
0   NM_136002.1  CG15142-RA (CG15142), mRNA 
0   11  42  NM_001032052.1  CG33715-RE, transcript variant E (Msp-300), mRNA 
0   11  NM_169909.1  CG5460-RB, transcript variant B (H), mRNA 
0   11  NM_169908.1  CG5460-RD, transcript variant D (H), mRNA 
0   11  NM_169907.1  CG5460-RA, transcript variant A (H), mRNA 
0   11  NM_079694.2  CG5460-RC, transcript variant C (H), mRNA 
0   NM_166331.1  CG15112-RB, transcript variant B (ena), mRNA 
0   NM_132660.2  CG1716-RA (CG1716), mRNA 
0   NM_141444.1  CG10061-RA (l(3)s2214), mRNA 
0   NM_058111.3  CG13388-RB, transcript variant B (Akap200), mRNA 
0   NM_164820.1  CG13388-RC, transcript variant C (Akap200), mRNA 
0   NM_175984.1  CG13388-RD, transcript variant D (Akap200), mRNA 
0   NM_058112.3  CG13388-RA, transcript variant A (Akap200), mRNA 
0   NM_169913.1  CG3856-RA, transcript variant A (Oamb), mRNA 
0   NM_169914.1  CG3856-RC, transcript variant C (Oamb), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.