National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 6474R-1 
 Symbol e(y)1  Full Name enhancer of yellow 1 
 CG No CG6474  Old CG No CG6474 
 Synonyms TAF[[II]]40, dmTAF9, Taf9, dmTaf9, dTAF[[II]]40, TAF40/42, dTAF9, TFIID, taf40/e(y)1, TAF[[II]], TAF[II]40, TAF9, dTAFII42, dTAF42, TAFII40, dTAF[[II]]42, d40, TAF40/42/e(y)1, CG6474, TFIID 42, TAFII40(42), TAF[[II]]40/42, Taf40, TAF42, TAF[[II]]42, dTAF[[40]], TAF40, dme-TAFII40, Taf42, Taf[[II]]40, p42, e(y)[1], e(y)4, TFIID-p42, e(y)1 
 Accession No (Link to NCBI) NM_078667.2 
 Inserted Chr. ll 
 Insertional Mutation  lethal 
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
 Reference
[Please submit your publication]
Xie G, Yu Z, Jia D, Jiao R, Deng WM.
E(y)1/TAF9 mediates the transcriptional output of Notch signaling in Drosophila.
J. Cell. Sci. (2014) 127(Pt 17) 3830-9 [ PubMed ID = 25015288 ] [ RRC reference ]

Jia D, Soylemez M, Calvin G, Bornmann R, Bryant J, Hanna C, Huang YC, Deng WM.
A large-scale in vivo RNAi screen to identify genes involved in Notch-mediated follicle cell differentiation and cell cycle switches.
Sci Rep (2015) 5 12328 [ PubMed ID = 26205122 ] [ RRC reference ]

Cho Y, Lai CM, Lin KY, Hsu HJ.
A Targeted RNAi Screen Reveals Drosophila Female-Sterile Genes That Control the Size of Germline Stem Cell Niche During Development.
G3 (Bethesda) (2018) 8(7) 2345-2354 [ PubMed ID = 29764959 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgATGAGCGCAGAGAAGTCCGAT 
 Primer Seq. 3'
aatctagaggtaccATTGGCGCTGGAGACGGGCTT 
 Predicted Fragment Size
495 
 IR fragment full Seq
0001 ATGAGCGCAG AGAAGTCCGA TAAGGCCAAG ATCAGTGCCC AAATCAAGCA CGTGCCGAAG 
0061 GACGCGCAGG TGATCATGTC CATCCTGAAG GAGCTGAATG TCCAGGAGTA CGAGCCGCGC 
0121 GTNGGTCAAC CAACTGCTGG AGTTCACCTT CCGCTATGTC ACCTGCATTC TGGACGACGC 
0181 CAAGGTATAC GCCAACCATG CGCGCAAGAA GACCATCGAC TTGGACGACG TGCGTCTGGC 
0241 CACCGAGGTT ACGCTGGACA AGAGCTTCAC CGGGCCGTTG GAGCGCCACG TTCTAGCCAA 
0301 GGTGGCCGAC GTGCGCAACA GCATGCCCCT GCCACCCATT AAGCCGCACT GcGGTCTCCN 
0361 GACTGCCGCC CGACCGCTAC TGTCTCACCG GCGTCAACTA CAAACTGCGG GCCACTAATC 
0421 AGCCCAAGAA AATGACCAAG TCGGCGGTGG AGGGCCGTCC ACTGAAGACC GTCGTTAAGC 
0481 CCGTCTCCAG CGCCAAT 
 in silico PCR Fragment
0001 ATGAGCGCAG AGAAGTCCGA TAAGGCCAAG ATCAGTGCCC AAATCAAGCA CGTGCCGAAG 
0061 GACGCGCAGG TGATCATGTC CATCCTGAAG GAGCTGAATG TCCAGGAGTA CGAGCCGCGC 
0121 GT-GGTCAAC CAACTGCTGG AGTTCACCTT CCGCTATGTA ACCTGCATTC TGGACGACGC 
0181 CAAGGTGTAC GCCAACCATG CGCGCAAGAA GACCATCGAC TTGGACGACG TGCGTCTGGC 
0241 CACCGAGGTT ACGCTGGACA AGAGCTTCAC CGGGCCGTTG GAGCGCCACG TTCTAGCCAA 
0301 GGTGGCCGAC GTGCGCAACA GCATGCCCCT GCCACCCATT AAGCCGCACT GCGGTCTCC- 
0361 GACTGCCGCC CGACCGCTAC TGTCTCACCG GCGTCAACTA CAAACTGCGG GCCACTAATC 
0421 AGCCCAAGAA AATGACCAAG TCGGCGGTGG AGGGCCGTCC ACTGAAGACC GTCGTTAAGC 
0481 CCGTCTCCAG CGCCAAT 
 Assemble Data

6474R-1.IR_full       1   ATGAGCGCAGAGAAGTCCGATAAGGCCAAGATCAGTGCCCAAATCAAGCACGTGCCGAAG 60
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
6474R-1.in silico     1   ATGAGCGCAGAGAAGTCCGATAAGGCCAAGATCAGTGCCCAAATCAAGCACGTGCCGAAG 60


6474R-1.IR_full       61  GACGCGCAGGTGATCATGTCCATCCTGAAGGAGCTGAATGTCCAGGAGTACGAGCCGCGC 120
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
6474R-1.in silico     61  GACGCGCAGGTGATCATGTCCATCCTGAAGGAGCTGAATGTCCAGGAGTACGAGCCGCGC 120


6474R-1.IR_full       121 GTNGGTCAACCAACTGCTGGAGTTCACCTTCCGCTATGTCACCTGCATTCTGGACGACGC 180
                          || |||||||||||||||||||||||||||||||||||| ||||||||||||||||||||
6474R-1.in silico     121 GT-GGTCAACCAACTGCTGGAGTTCACCTTCCGCTATGTAACCTGCATTCTGGACGACGC 180


6474R-1.IR_full       181 CAAGGTATACGCCAACCATGCGCGCAAGAAGACCATCGACTTGGACGACGTGCGTCTGGC 240
                          |||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||
6474R-1.in silico     181 CAAGGTGTACGCCAACCATGCGCGCAAGAAGACCATCGACTTGGACGACGTGCGTCTGGC 240


6474R-1.IR_full       241 CACCGAGGTTACGCTGGACAAGAGCTTCACCGGGCCGTTGGAGCGCCACGTTCTAGCCAA 300
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
6474R-1.in silico     241 CACCGAGGTTACGCTGGACAAGAGCTTCACCGGGCCGTTGGAGCGCCACGTTCTAGCCAA 300


6474R-1.IR_full       301 GGTGGCCGACGTGCGCAACAGCATGCCCCTGCCACCCATTAAGCCGCACTGCGGTCTCCN 360
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| 
6474R-1.in silico     301 GGTGGCCGACGTGCGCAACAGCATGCCCCTGCCACCCATTAAGCCGCACTGCGGTCTCC- 360


6474R-1.IR_full       361 GACTGCCGCCCGACCGCTACTGTCTCACCGGCGTCAACTACAAACTGCGGGCCACTAATC 420
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
6474R-1.in silico     361 GACTGCCGCCCGACCGCTACTGTCTCACCGGCGTCAACTACAAACTGCGGGCCACTAATC 420


6474R-1.IR_full       421 AGCCCAAGAAAATGACCAAGTCGGCGGTGGAGGGCCGTCCACTGAAGACCGTCGTTAAGC 480
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
6474R-1.in silico     421 AGCCCAAGAAAATGACCAAGTCGGCGGTGGAGGGCCGTCCACTGAAGACCGTCGTTAAGC 480


6474R-1.IR_full       481 CCGTCTCCAGCGCCAAT 497
                          |||||||||||||||||
6474R-1.in silico     481 CCGTCTCCAGCGCCAAT 497

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   477  NM_078667.2  CG6474-RA (e(y)1), mRNA 
0   NM_135384.2  CG13400-RA (D12), mRNA 
0   NM_165493.1  CG15236-RB, transcript variant B (CG15236), mRNA 
0   NM_136397.1  CG15236-RA, transcript variant A (CG15236), mRNA 
0   NM_132375.1  CG2972-RA (CG2972), mRNA 
0   NM_140010.1  CG13313-RA (CG13313), mRNA 
0   23  NM_141666.2  CG9492-RA (CG9492), mRNA 
0   NM_130658.2  CG10260-RB (CG10260), mRNA 
0   NM_135071.2  CG6514-RA (TpnC25D), mRNA 
0   NM_139511.2  CG1869-RA (CG1869), mRNA 
0   NM_136949.1  CG13151-RA (CG13151), mRNA 
0   NM_143476.2  CG7802-RA, transcript variant A (CG7802), mRNA 
0   NM_206583.1  CG7802-RB, transcript variant B (CG7802), mRNA 
0   NM_176328.1  CG17364-RB, transcript variant B (CG17364), mRNA 
0   NM_140417.2  CG17364-RA, transcript variant A (CG17364), mRNA 
0   NM_143091.1  CG13653-RA (CG13653), mRNA 
0   NM_138110.2  CG3683-RA, transcript variant A (CG3683), mRNA 
0   NM_166680.1  CG3683-RB, transcript variant B (CG3683), mRNA 
0   NM_166681.1  CG3683-RC, transcript variant C (CG3683), mRNA 
0   NM_170644.1  CG32464-RA, transcript variant A (l(3)82Fd), mRNA 
0   NM_169045.1  CG32464-RH, transcript variant H (l(3)82Fd), mRNA 
0   NM_170643.1  CG32464-RC, transcript variant C (l(3)82Fd), mRNA 
0   NM_170642.1  CG32464-RI, transcript variant I (l(3)82Fd), mRNA 
0   NM_170641.1  CG32464-RF, transcript variant F (l(3)82Fd), mRNA 
0   NM_001043214.1  CG32464-RO, transcript variant O (l(3)82Fd), mRNA 
0   NM_170640.2  CG32464-RK, transcript variant K (l(3)82Fd), mRNA 
0   NM_206429.1  CG32464-RG, transcript variant G (l(3)82Fd), mRNA 
0   NM_001031978.1  CG32464-RM, transcript variant M (l(3)82Fd), mRNA 
0   NM_169039.2  CG32464-RL, transcript variant L (l(3)82Fd), mRNA 
0   NM_143760.2  CG32464-RB, transcript variant B (l(3)82Fd), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.