National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock discarded request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 6467R-2 
 Symbol Jon65Aiv  Full Name Jonah 65Aiv 
 CG No CG6467  Old CG No CG6467 
 Synonyms CG6467, SP117, Jon65A, Jon65Aiv 
 Accession No (Link to NCBI) NM_139755.2 
 Inserted Chr. ll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees viable 
 Map Viewer
 Reference
[Please submit your publication]
Umemori M, Habara O, Iwata T, Maeda K, Nishinoue K, Okabe A, Takemura M, Takahashi K, Saigo K, Ueda R, Adachi-Yamada T.
RNAi-mediated knockdown showing impaired cell survival in Drosophila wing imaginal disc.
Gene Regul Syst Bio (2009) 3 11-20 [ PubMed ID = 19838331 ] [ RRC reference ]

Kambris Z, Brun S, Jang IH, Nam HJ, Romeo Y, Takahashi K, Lee WJ, Ueda R, Lemaitre B.
Drosophila immunity: a large-scale in vivo RNAi screen identifies five serine proteases required for Toll activation.
Curr Biol (2006) 16(8) 808-13 [ PubMed ID = 16631589 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgTTGGCGACATTGGAGGTCGCA 
 Primer Seq. 3'
aatctagaggtaccGGTTTGGGCGCACTTGGTGTT 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 TTGGCGACAT TGGAGGTCGC ATCACCGGAG GAAGCAANCG CCgCCGTCGG CCAGTTCCCC 
0061 TACCAGGTGG GACTTTCCCT GAAGCTGAGT GCTCTGTCCA GCGCCTGGTG CGGTGGTTCT 
0121 CTGATCGGCA GCACCTGGGT CCTGACCGCT GCTCACTGTA CCGATGGAGT TCAGTCCGTG 
0181 ACCGTCTACT TGGGCGCCAC CGTGCGCACC TCCGCCGAGA TCACCCACAC CGTGTCCAGC 
0241 TCCGACATCA TCATCCACTC CGGCTGGAAC AGCGCTAACC TGCGCAACGA CATCTCCCTG 
0301 ATCAAGATCC CCGCCACCTC CTCCAGCAGC AGGATCTCCG CCGTCAAGCT GCCAAGCATC 
0361 TCCAACTCCT ACTCGACCTT CGTCGGTGAC GTCGCTGTCG cCTCCGGATG GGGACGCACC 
0421 AGTGACACCT CCAGTGGTGT GGCTACCAAT CTTCAGTATG TCGACCTGAC TGTGATCACC 
0481 AACACCAAGT GCGCCCAAAC C 
 in silico PCR Fragment
0001 TTGGCGACAT TGGAGGTCGC ATCACCGGAG GAAGCAA-CG CCGCCGTCGG CCAGTTCCCC 
0061 TACCAGGTGG GACTTTCCCT GAAGCTGAGT GCTCTGTCCA GCGCCTGGTG CGGTGGTTCT 
0121 CTGATCGGCA GCACCTGGGT CCTGACCGCT GCTCACTGTA CCGATGGAGT TCAGTCCGTG 
0181 ACCGTCTACT TGGGCGCCAC CGTGCGCACC TCCGCCGAGA TCACCCACAC CGTGTCCAGC 
0241 TCCGACATCA TCATCCACTC CGGCTGGAAC AGCGCTAACC TGCGCAACGA CATCTCCCTG 
0301 ATCAAGATCC CCGCCACCTC CTCCAGCAGC AGGATCTCCG CCGTCAAGCT GCCAAGCATC 
0361 TCCAACTCCT ACTCGACCTT CGTCGGTGAC GTCGCTGTCG CCTCCGGATG GGGACGCACC 
0421 AGTGACACCT CCAGTGGTGT GGCTACCAAT CTTCAGTATG TCGACCTGAC TGTGATCACC 
0481 AACACCAAGT GCGCCCAAAC C 
 Assemble Data

6467R-2.IR_full       1   TTGGCGACATTGGAGGTCGCATCACCGGAGGAAGCAANCGCCGCCGTCGGCCAGTTCCCC 60
                          ||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||
6467R-2.in silico     1   TTGGCGACATTGGAGGTCGCATCACCGGAGGAAGCAA-CGCCGCCGTCGGCCAGTTCCCC 60


6467R-2.IR_full       61  TACCAGGTGGGACTTTCCCTGAAGCTGAGTGCTCTGTCCAGCGCCTGGTGCGGTGGTTCT 120
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
6467R-2.in silico     61  TACCAGGTGGGACTTTCCCTGAAGCTGAGTGCTCTGTCCAGCGCCTGGTGCGGTGGTTCT 120


6467R-2.IR_full       121 CTGATCGGCAGCACCTGGGTCCTGACCGCTGCTCACTGTACCGATGGAGTTCAGTCCGTG 180
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
6467R-2.in silico     121 CTGATCGGCAGCACCTGGGTCCTGACCGCTGCTCACTGTACCGATGGAGTTCAGTCCGTG 180


6467R-2.IR_full       181 ACCGTCTACTTGGGCGCCACCGTGCGCACCTCCGCCGAGATCACCCACACCGTGTCCAGC 240
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
6467R-2.in silico     181 ACCGTCTACTTGGGCGCCACCGTGCGCACCTCCGCCGAGATCACCCACACCGTGTCCAGC 240


6467R-2.IR_full       241 TCCGACATCATCATCCACTCCGGCTGGAACAGCGCTAACCTGCGCAACGACATCTCCCTG 300
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
6467R-2.in silico     241 TCCGACATCATCATCCACTCCGGCTGGAACAGCGCTAACCTGCGCAACGACATCTCCCTG 300


6467R-2.IR_full       301 ATCAAGATCCCCGCCACCTCCTCCAGCAGCAGGATCTCCGCCGTCAAGCTGCCAAGCATC 360
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
6467R-2.in silico     301 ATCAAGATCCCCGCCACCTCCTCCAGCAGCAGGATCTCCGCCGTCAAGCTGCCAAGCATC 360


6467R-2.IR_full       361 TCCAACTCCTACTCGACCTTCGTCGGTGACGTCGCTGTCGCCTCCGGATGGGGACGCACC 420
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
6467R-2.in silico     361 TCCAACTCCTACTCGACCTTCGTCGGTGACGTCGCTGTCGCCTCCGGATGGGGACGCACC 420


6467R-2.IR_full       421 AGTGACACCTCCAGTGGTGTGGCTACCAATCTTCAGTATGTCGACCTGACTGTGATCACC 480
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
6467R-2.in silico     421 AGTGACACCTCCAGTGGTGTGGCTACCAATCTTCAGTATGTCGACCTGACTGTGATCACC 480


6467R-2.IR_full       481 AACACCAAGTGCGCCCAAACC 501
                          |||||||||||||||||||||
6467R-2.in silico     481 AACACCAAGTGCGCCCAAACC 501

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_139755.2  CG6467-RA (Jon65Aiv), mRNA 
2.69   13  19  20  25  NM_079220.1  CG6457-RA (yip7), mRNA 
1.86   16  NM_139753.1  CG10477-RA (CG10477), mRNA 
1.65   10  34  NM_139756.2  CG6483-RA (Jon65Aiii), mRNA 
1.24   10  NM_139760.1  CG10472-RA (CG10472), mRNA 
0.82   17  NM_140737.1  CG6298-RA (Jon74E), mRNA 
0.2   26  13  24  NM_170451.2  CG31362-RA (Jon99Ciii), mRNA 
0.2   20  15  25  NM_079830.2  CG31034-RA (Jon99Cii), mRNA 
0.2   20  15  21  NM_143542.1  CG2229-RA (Jon99Fii), mRNA 
0.2   14  19  22  NM_143543.2  CG18030-RA (Jon99Fi), mRNA 
0   15  21  NM_001038784.1  CG8867-RB, transcript variant B (Jon25Bi), mRNA 
0   15  21  NM_078753.2  CG8867-RA, transcript variant A (Jon25Bi), mRNA 
0   18  NM_165618.1  CG8579-RA (Jon44E), mRNA 
0   NM_132758.1  CG9504-RA (Eo), mRNA 
0   18  NM_135038.1  CG8869-RA (Jon25Bii), mRNA 
0   NM_079614.2  CG7996-RA (snk), mRNA 
0   NM_078496.2  CG3025-RA (mof), mRNA 
0   NR_001704.1  CR30370, miscRNA 
0   NM_165600.1  CG30375-RA (CG30375), mRNA 
0   NM_140082.1  CG8329-RA (CG8329), mRNA 
0   NM_079133.1  CG3629-RA, transcript variant A (Dll), mRNA 
0   NM_166689.1  CG3629-RB, transcript variant B (Dll), mRNA 
0   NM_136265.2  CG17571-RA (CG17571), mRNA 
0   NM_057483.3  CG10181-RA (Mdr65), mRNA 
0   NM_132959.2  CG8949-RA (CG8949), mRNA 
0   NM_165949.1  CG8657-RA (Dgkepsilon), mRNA 
0   NM_140289.2  CG17153-RA (CG17153), mRNA 
0   NM_137177.2  CG11808-RA (CG11808), mRNA 
0   NM_169092.1  CG1109-RB, transcript variant B (CG1109), mRNA 
0   NM_169091.1  CG1109-RA, transcript variant A (CG1109), mRNA 
 Wing Disc
GFP
Puc
Caspase
DAPI
Merge
Figure
JNK signal
N
 
DB
 
DC
 
DM
 
VM
 
VB
 
Caspase-3 signal
N
++ 
DB
DC
++ 
DM
VM
 
VB
 
Dcompartment   Penetrance
     

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.