National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock discarded request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 6457R-1 
 Symbol yip7  Full Name yippee interacting protein 7 
 CG No CG6457  Old CG No CG6457 
 Synonyms SP116, SPH116, MAC, mac, CG6457, yip7 
 Accession No (Link to NCBI) NM_079220.1 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees viable 
 Map Viewer
 Reference
[Please submit your publication]
Kambris Z, Brun S, Jang IH, Nam HJ, Romeo Y, Takahashi K, Lee WJ, Ueda R, Lemaitre B.
Drosophila immunity: a large-scale in vivo RNAi screen identifies five serine proteases required for Toll activation.
Curr Biol (2006) 16(8) 808-13 [ PubMed ID = 16631589 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgTCGTAGTTTTGGTTCTGGCTC 
 Primer Seq. 3'
aatctagaggtaccAGACCCCATCCGGAGGCAACA 
 Predicted Fragment Size
499 
 IR fragment full Seq
0001 TCGTAGTTTT GGTTCTGGCT CTGGcCTCCG CCTCCGCTGG GCTCCTGCCC AATATTGCCC 
0061 CTGTACATCC CCGTGACAGG GTCTCGACCC CATCCATCAC CGGTCGCATC ACCAACGGCA 
0121 AGNGACGCCG TTGCCGGCCA GTTCCCCTAC CAGGTGGGAC TTAGTTTNCT CCAGCTCTGC 
0181 TGGCAGTTGG TGGTGCGGTG GCTCCATCAT CGGAAACGAG TGGGTGCTGA CTGCTGCTCA 
0241 CTGTACCGAC GGTGCCGCCT CCGTGACCAT CTACTACGGT GCCACTGTCC GTACTAGCCC 
0301 CGAGTTCACC CAAGTCGTCA GCAGCTCAAA GTTTAGGCAG CACGAAAGCT ACCTGGCTTT 
0361 GACCATCCGC AACGACATCT CCCTGATNCC AGaCTTCGTC CGTGTCCTTC TCGGCTACCG 
0421 TGAACAAGAT CAGCCTGCCC GCCGTCTCCA ACAGCTACTC CACCTACGAG GGAAAGACCG 
0481 CTGTTGcCTC CGGATGGGGT CT 
 in silico PCR Fragment
0001 TCGTAGTTTT GGTTCTGGCT CTGGCCTCCG CCTCCGCTGG GCTCCTGCCC AATATTGCCC 
0061 CTGTACATCC CCGTGACAGG GTCTCGACCC CATCCATCAC CGGTCGCATC ACCAACGGCA 
0121 AG-GACGCCG TTGCCGGCCA GTTCCCCTAC CAGGTGGGAC TTAGTTT-CT CCAGCTCTGC 
0181 TGGCAGTTGG TGGTGCGGTG GCTCCATCAT CGGAAACGAG TGGGTGCTGA CTGCTGCTCA 
0241 CTGTACCGAC GGTGCCGCCT CCGTGACCAT CTACTACGGT GCCACTGTCC GTACTAGCCC 
0301 CGAGTTCACC CAAGTCGTCA GCAGCTCAAA GTTTAGGCAG CACGAAAGCT ACCTGGCTTT 
0361 GACCATCCGC AACGACATCT CCCTGAT-CC AGACTTCGTC CGTGTCCTTC TCGGCTACCG 
0421 TGAACAAGAT CAGCCTGCCC GCCGTCTCCA ACAGCTACTC CACCTACGAG GGAAAGACCG 
0481 CTGTTGCCTC CGGATGGGGT CT 
 Assemble Data

6457R-1.IR_full       1   TCGTAGTTTTGGTTCTGGCTCTGGCCTCCGCCTCCGCTGGGCTCCTGCCCAATATTGCCC 60
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
6457R-1.in silico     1   TCGTAGTTTTGGTTCTGGCTCTGGCCTCCGCCTCCGCTGGGCTCCTGCCCAATATTGCCC 60


6457R-1.IR_full       61  CTGTACATCCCCGTGACAGGGTCTCGACCCCATCCATCACCGGTCGCATCACCAACGGCA 120
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
6457R-1.in silico     61  CTGTACATCCCCGTGACAGGGTCTCGACCCCATCCATCACCGGTCGCATCACCAACGGCA 120


6457R-1.IR_full       121 AGNGACGCCGTTGCCGGCCAGTTCCCCTACCAGGTGGGACTTAGTTTNCTCCAGCTCTGC 180
                          || |||||||||||||||||||||||||||||||||||||||||||| ||||||||||||
6457R-1.in silico     121 AG-GACGCCGTTGCCGGCCAGTTCCCCTACCAGGTGGGACTTAGTTT-CTCCAGCTCTGC 180


6457R-1.IR_full       181 TGGCAGTTGGTGGTGCGGTGGCTCCATCATCGGAAACGAGTGGGTGCTGACTGCTGCTCA 240
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
6457R-1.in silico     181 TGGCAGTTGGTGGTGCGGTGGCTCCATCATCGGAAACGAGTGGGTGCTGACTGCTGCTCA 240


6457R-1.IR_full       241 CTGTACCGACGGTGCCGCCTCCGTGACCATCTACTACGGTGCCACTGTCCGTACTAGCCC 300
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
6457R-1.in silico     241 CTGTACCGACGGTGCCGCCTCCGTGACCATCTACTACGGTGCCACTGTCCGTACTAGCCC 300


6457R-1.IR_full       301 CGAGTTCACCCAAGTCGTCAGCAGCTCAAAGTTTAGGCAGCACGAAAGCTACCTGGCTTT 360
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
6457R-1.in silico     301 CGAGTTCACCCAAGTCGTCAGCAGCTCAAAGTTTAGGCAGCACGAAAGCTACCTGGCTTT 360


6457R-1.IR_full       361 GACCATCCGCAACGACATCTCCCTGATNCCAGACTTCGTCCGTGTCCTTCTCGGCTACCG 420
                          ||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||
6457R-1.in silico     361 GACCATCCGCAACGACATCTCCCTGAT-CCAGACTTCGTCCGTGTCCTTCTCGGCTACCG 420


6457R-1.IR_full       421 TGAACAAGATCAGCCTGCCCGCCGTCTCCAACAGCTACTCCACCTACGAGGGAAAGACCG 480
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
6457R-1.in silico     421 TGAACAAGATCAGCCTGCCCGCCGTCTCCAACAGCTACTCCACCTACGAGGGAAAGACCG 480


6457R-1.IR_full       481 CTGTTGCCTCCGGATGGGGTCT 502
                          ||||||||||||||||||||||
6457R-1.in silico     481 CTGTTGCCTCCGGATGGGGTCT 502

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   481  NM_079220.1  CG6457-RA (yip7), mRNA 
2.7   13  19  17  20  NM_139755.2  CG6467-RA (Jon65Aiv), mRNA 
2.28   11  23  44  56  NM_139756.2  CG6483-RA (Jon65Aiii), mRNA 
1.66   34  29  59  NM_139753.1  CG10477-RA (CG10477), mRNA 
1.45   19  NM_135037.1  CG8871-RA (Jon25Biii), mRNA 
1.24   11  29  NM_168271.1  CG7118-RA (Jon66Ci), mRNA 
1.24   13  24  NM_139760.1  CG10472-RA (CG10472), mRNA 
0.41   15  18  20  NM_143543.2  CG18030-RA (Jon99Fi), mRNA 
0.41   14  20  29  NM_170451.2  CG31362-RA (Jon99Ciii), mRNA 
0.41   14  20  16  NM_079830.2  CG31034-RA (Jon99Cii), mRNA 
0.41   11  21  19  NM_143542.1  CG2229-RA (Jon99Fii), mRNA 
0   16  14  19  NM_135038.1  CG8869-RA (Jon25Bii), mRNA 
0   13  27  18  NM_001038784.1  CG8867-RB, transcript variant B (Jon25Bi), mRNA 
0   13  27  18  NM_078753.2  CG8867-RA, transcript variant A (Jon25Bi), mRNA 
0   10  NM_139758.1  CG10475-RA (Jon65Ai), mRNA 
0   15  21  NM_139960.1  CG7170-RA (Jon66Cii), mRNA 
0   17  NM_206008.1  CG33316-RB, transcript variant B (CG33316), mRNA 
0   17  NM_206007.1  CG33316-RA, transcript variant A (CG33316), mRNA 
0   NM_143286.1  CG5896-RB, transcript variant B (CG5896), mRNA 
0   NM_170318.1  CG5896-RA, transcript variant A (CG5896), mRNA 
0   NM_176544.1  CG33193-RA (sav), mRNA 
0   NM_137951.1  CG5357-RA (CG5357), mRNA 
0   26  NM_139757.1  CG6580-RA (Jon65Aii), mRNA 
0   NM_001043081.1  CG11798-RD, transcript variant D (chn), mRNA 
0   NM_136129.2  CG10194-RA (CG10194), mRNA 
0   NM_132645.2  CG15745-RA, transcript variant A (CG15745), mRNA 
0   NM_167357.1  CG15745-RB, transcript variant B (CG15745), mRNA 
0   NM_167394.1  CG32603-RA (CG32603), mRNA 
0   12  20  NM_079831.2  CG31039-RA (Jon99Ci), mRNA 
0   NM_136501.1  CG11191-RA (CG11191), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.