National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 6394R-2 
 Symbol GalNAc-T2  Full Name UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 2 
 CG No CG6394  Old CG No CG6394 
 Synonyms pgant7, CG6394, dGalNAc-T2, anon-WO02059370.15, GalNAc-T2 
 Accession No (Link to NCBI)  
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees late pupal lethal 
 Map Viewer
 Reference
[Please submit your publication]
Yamamoto-Hino M, Yoshida H, Ichimiya T, Sakamura S, Maeda M, Kimura Y, Sasaki N, Aoki-Kinoshita KF, Kinoshita-Toyoda A, Toyoda H, Ueda R, Nishihara S, Goto S.
Phenotype-based clustering of glycosylation-related genes by RNAi-mediated gene silencing.
Genes Cells (2015) 20(6) 521-42 [ PubMed ID = 25940448 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgGATCTGCCGGCTGGCATTGTG 
 Primer Seq. 3'
aatctagaggtaccTCTCGTGCAGCATGTGCGTGG 
 Predicted Fragment Size
500 
 IR fragment full Seq
 
 in silico PCR Fragment
 
 Assemble Data

6394R-2.IR full       1   GATCTGCCGGCTGGCATTGTGCCTGCTGGTACTGCTGCCGCTGCTGTATCTGCTGGCCAA 60
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
6394R-2.in silico     1   GATCTGCCGGCTGGCATTGTGCCTGCTGGTACTGCTGCCGCTGCTGTATCTGCTGGCCAA 60


6394R-2.IR full       61  CTGGAGCGATCACCACAAGCGCGTCCAGGAGGCGTATCACACGCGCTTCGGCGGACCCAA 120
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
6394R-2.in silico     61  CTGGAGCGATCACCACAAGCGCGTCCAGGAGGCGTATCACACGCGCTTCGGCGGACCCAA 120


6394R-2.IR full       121 GTTCGCCCACCAGCGATTGGAGGGCAGGCCCAGGGAGGTGCCCAAGCTGGTCGATGGCCT 180
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
6394R-2.in silico     121 GTTCGCCCACCAGCGATTGGAGGGCAGGCCCAGGGAGGTGCCCAAGCTGGTCGATGGCCT 180


6394R-2.IR full       181 TGGCAACTTTGAGCCGAAAGATGTGAAGCCACGTAGCGGGCCTGGCGAGAATGGCGAGGC 240
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
6394R-2.in silico     181 TGGCAACTTTGAGCCGAAAGATGTGAAGCCACGTAGCGGGCCTGGCGAGAATGGCGAGGC 240


6394R-2.IR full       241 CCACAGCCTGTCGCCGGACAAGAAGCACATGTCGGACGCCTCCGAGATGGAGTACGGCAT 300
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
6394R-2.in silico     241 CCACAGCCTGTCGCCGGACAAGAAGCACATGTCGGACGCCTCCGAGATGGAGTACGGCAT 300


6394R-2.IR full       301 GAACATCGCCTGCTCCGATGAGATATCGATGCACCGATCGGTGCGGGACACGCGGCTCGA 360
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
6394R-2.in silico     301 GAACATCGCCTGCTCCGATGAGATATCGATGCACCGATCGGTGCGGGACACGCGGCTCGA 360


6394R-2.IR full       361 AGAGTGCCGCCACTGGGACTACCCCTTCGATCTGCCGCGCACGAGCGTCATCATTGTCTT 420
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
6394R-2.in silico     361 AGAGTGCCGCCACTGGGACTACCCCTTCGATCTGCCGCGCACGAGCGTCATCATTGTCTT 420


6394R-2.IR full       421 CCACAACGAGGGCTTCTCGGTGCTGATGCGCACCGTGCACTCGGTCATCGATCGTTCGCC 480
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
6394R-2.in silico     421 CCACAACGAGGGCTTCTCGGTGCTGATGCGCACCGTGCACTCGGTCATCGATCGTTCGCC 480


6394R-2.IR full       481 CACGCACATGCTGCACGAGA 500
                          ||||||||||||||||||||
6394R-2.in silico     481 CACGCACATGCTGCACGAGA 500

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100  482  NM_167623.1  UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 2 CG6394-RB, transcript variant B (GalNAc-T2), mRNA 
100  482  NM_133073.2  UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 2 CG6394-RA, transcript variant A (GalNAc-T2), mRNA 
0.2  NM_140771.2  CG5147-RA (CG5147), mRNA 
19  NM_139371.1  CG13917-RA (CG13917), mRNA 
82  NM_139493.2  CG2083-RA (CG2083), mRNA 
16  NM_143623.1  kek6 CG1804-RA (kek6), mRNA 
30  NM_001014630.1  Rim CG33547-RA (Rim), mRNA 
19  NM_136857.2  thisbe CG12443-RA (ths), mRNA 
NM_140678.1  CG13023-RA (CG13023), mRNA 
NM_168744.1  Ccn CG32183-RB, transcript variant B (Ccn), mRNA 
NM_168745.1  Ccn CG32183-RA, transcript variant A (Ccn), mRNA 
63  NM_143409.1  CG11873-RA (CG11873), mRNA 
24  NM_135793.2  CG16970-RA (CG16970), mRNA 
25  NM_143352.1  CG12870-RA (CG12870), mRNA 
NM_167317.1  Cyp311a1 CG1488-RA, transcript variant A (Cyp311a1), mRNA 
NM_132552.2  Cyp311a1 CG1488-RB, transcript variant B (Cyp311a1), mRNA 
29  NM_168096.1  CG32245-RB, transcript variant B (CG32245), mRNA 
24  NM_143148.1  CG5079-RA (CG5079), mRNA 
12  NM_168681.2  Lasp CG3849-RB, transcript variant B (Lasp), mRNA 
14  NM_175960.3  dumpy CG33196-RB (dp), mRNA 
11  NM_168095.2  CG32245-RC, transcript variant C (CG32245), mRNA 
11  NM_139660.3  CG32245-RA, transcript variant A (CG32245), mRNA 
23  NM_176509.1  tincar CG31247-RA, transcript variant A (tinc), mRNA 
23  NM_176510.1  tincar CG31247-RD, transcript variant D (tinc), mRNA 
23  NM_169780.2  tincar CG31247-RB, transcript variant B (tinc), mRNA 
NM_176511.1  tincar CG31247-RC, transcript variant C (tinc), mRNA 
NM_136710.2  CG1381-RA (CG1381), mRNA 
31  NM_170365.1  La related protein CG14066-RC, transcript variant C (larp), mRNA 
31  NM_170366.1  La related protein CG14066-RB, transcript variant B (larp), mRNA 
31  NM_080259.1  La related protein CG14066-RA, transcript variant A (larp), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.