National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 6284R-4 
 Symbol Sirt6  Full Name Sirt6 
 CG No CG6284  Old CG No CG6284 
 Synonyms dmSRT408, CG6284, dSIRT6, D.mel4, Sirt6 
 Accession No (Link to NCBI) NM_141733.1 
 Inserted Chr. ll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees abnormal wing 
 Map Viewer
 Reference
[Please submit your publication]
Kusama S, Ueda R, Suda T, Nishihara S, Matsuura ET.
Involvement of Drosophila Sir2-like genes in the regulation of life span.
Genes Genet. Syst. (2006) 81(5) 341-8 [ PubMed ID = 17159295 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgACTACGCGGATGGATTGTCAG 
 Primer Seq. 3'
aatctagaggtaccGATCTACAGCTACGACCTTTG 
 Predicted Fragment Size
526 
 IR fragment full Seq
0001 ACTACGCGGA TGGATTGTCA GCCTACGACA ACAAGGGAAT TTTGGGAGCA CCAGAGAGTT 
0061 TCGACAGCGA TGAGGTTGTG GCCGAAAAGT GCCAGGAATT GGCTGAATTG ATCAAGAAAT 
0121 CGGGACACGT TGTCCTCCAC ACGGGAGCTG GGATCAGTAC GTCTGCAGGA ATTCCGGATT 
0181 TCCGCGGACC CAAGGGCGTT TGGACCCTGG AGGAGAAGGG CGAGAAGCCG GACTTCAATG 
0241 TTTCCTTCGA TGAAGCCAGA CCAACTAAAA CCCACATGGC TATCATAGCC CTGATTGAAA 
0301 GTGGCTATGT GCAGTACGTA ATCTCACAGA ATATTGATGG TCTCCACTTG AAATCCGGAC 
0361 TGGATCGGAA GTATCTTTCC GAATTGCACG GCAACATTTA CATCGAACAG TGTAAGAAAT 
0421 GCAGACGGCA ATTTGTGAGC CCATCTGCCG TGGAAACAGT GGGTCAAAAA TCCCTGCAAC 
0481 GTGCCTGCAA GTCTTCAATG GATAGCAAAG GTCGTAGCTG TAGATC 
 in silico PCR Fragment
0001 ACTACGCGGA TGGATTGTCA GCCTACGACA ACAAGGGAAT TTTGGGAGCA CCAGAGAGTT 
0061 TCGACAGCGA TGAGGTTGTG GCCGAAAAGT GCCAGGAATT GGCTGAATTG ATCAAGAAAT 
0121 CGGGACACGT TGTCCTCCAC ACGGGAGCTG GGATCAGTAC GTCTGCAGGA ATTCCGGATT 
0181 TCCGCGGACC CAAGGGCGTT TGGACCCTGG AGGAGAAGGG CGAGAAGCCG GACTTCAATG 
0241 TTTCCTTCGA TGAAGCCAGA CCAACTAAAA CCCACATGGC TATCATAGCC CTGATTGAAA 
0301 GTGGCTATGT GCAGTACGTA ATCTCACAGA ATATTGATGG TCTCCACTTG AAATCCGGAC 
0361 TGGATCGGAA GTATCTTTCC GAATTGCACG GCAACATTTA CATCGAACAG TGTAAGAAAT 
0421 GCAGACGGCA ATTTGTGAGC CCATCTGCCG TGGAAACAGT GGGTCAAAAA TCCCTGCAAC 
0481 GTGCCTGCAA GTCTTCAATG GATAGCAAAG GTCGTAGCTG TAGATC 
 Assemble Data

6284R-4.IR_full       1   ACTACGCGGATGGATTGTCAGCCTACGACAACAAGGGAATTTTGGGAGCACCAGAGAGTT 60
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
6284R-4.in silico     1   ACTACGCGGATGGATTGTCAGCCTACGACAACAAGGGAATTTTGGGAGCACCAGAGAGTT 60


6284R-4.IR_full       61  TCGACAGCGATGAGGTTGTGGCCGAAAAGTGCCAGGAATTGGCTGAATTGATCAAGAAAT 120
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
6284R-4.in silico     61  TCGACAGCGATGAGGTTGTGGCCGAAAAGTGCCAGGAATTGGCTGAATTGATCAAGAAAT 120


6284R-4.IR_full       121 CGGGACACGTTGTCCTCCACACGGGAGCTGGGATCAGTACGTCTGCAGGAATTCCGGATT 180
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
6284R-4.in silico     121 CGGGACACGTTGTCCTCCACACGGGAGCTGGGATCAGTACGTCTGCAGGAATTCCGGATT 180


6284R-4.IR_full       181 TCCGCGGACCCAAGGGCGTTTGGACCCTGGAGGAGAAGGGCGAGAAGCCGGACTTCAATG 240
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
6284R-4.in silico     181 TCCGCGGACCCAAGGGCGTTTGGACCCTGGAGGAGAAGGGCGAGAAGCCGGACTTCAATG 240


6284R-4.IR_full       241 TTTCCTTCGATGAAGCCAGACCAACTAAAACCCACATGGCTATCATAGCCCTGATTGAAA 300
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
6284R-4.in silico     241 TTTCCTTCGATGAAGCCAGACCAACTAAAACCCACATGGCTATCATAGCCCTGATTGAAA 300


6284R-4.IR_full       301 GTGGCTATGTGCAGTACGTAATCTCACAGAATATTGATGGTCTCCACTTGAAATCCGGAC 360
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
6284R-4.in silico     301 GTGGCTATGTGCAGTACGTAATCTCACAGAATATTGATGGTCTCCACTTGAAATCCGGAC 360


6284R-4.IR_full       361 TGGATCGGAAGTATCTTTCCGAATTGCACGGCAACATTTACATCGAACAGTGTAAGAAAT 420
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
6284R-4.in silico     361 TGGATCGGAAGTATCTTTCCGAATTGCACGGCAACATTTACATCGAACAGTGTAAGAAAT 420


6284R-4.IR_full       421 GCAGACGGCAATTTGTGAGCCCATCTGCCGTGGAAACAGTGGGTCAAAAATCCCTGCAAC 480
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
6284R-4.in silico     421 GCAGACGGCAATTTGTGAGCCCATCTGCCGTGGAAACAGTGGGTCAAAAATCCCTGCAAC 480


6284R-4.IR_full       481 GTGCCTGCAAGTCTTCAATGGATAGCAAAGGTCGTAGCTGTAGATC 526
                          ||||||||||||||||||||||||||||||||||||||||||||||
6284R-4.in silico     481 GTGCCTGCAAGTCTTCAATGGATAGCAAAGGTCGTAGCTGTAGATC 526

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   508  NM_141733.1  CG6284-RA (Sirt6), mRNA 
0.19   NM_135491.2  CG31755-RA (CG31755), mRNA 
0   NM_140963.1  CG5847-RA (CG5847), mRNA 
0   NM_080325.3  CG6450-RC (lva), mRNA 
0   NM_001043040.1  CG17800-PAJ (Dscam), mRNA 
0   NM_001043041.1  CG17800-PBE (Dscam), mRNA 
0   NM_001043045.1  CG17800-PAK (Dscam), mRNA 
0   NM_001043014.1  CG17800-PAL (Dscam), mRNA 
0   NM_001043057.1  CG17800-PAM (Dscam), mRNA 
0   NM_001043038.1  CG17800-PAN (Dscam), mRNA 
0   NM_001043059.1  CG17800-PAO (Dscam), mRNA 
0   NM_001043051.1  CG17800-PAP (Dscam), mRNA 
0   NM_001043023.1  CG17800-PAQ (Dscam), mRNA 
0   NM_001043027.1  CG17800-PAR (Dscam), mRNA 
0   NM_001043019.1  CG17800-PAS (Dscam), mRNA 
0   NM_078925.5  CG17800-RD, transcript variant D (Dscam), mRNA 
0   NM_001043021.1  CG17800-PAT (Dscam), mRNA 
0   NM_001043037.1  CG17800-PAU (Dscam), mRNA 
0   NM_001043039.1  CG17800-PAV (Dscam), mRNA 
0   NM_001043017.1  CG17800-PAW (Dscam), mRNA 
0   NM_001043015.1  CG17800-PAX (Dscam), mRNA 
0   NM_001043032.1  CG17800-PAY (Dscam), mRNA 
0   NM_001043024.1  CG17800-PBC (Dscam), mRNA 
0   NM_001043035.1  CG17800-RT, transcript variant T (Dscam), mRNA 
0   NM_001043046.1  CG17800-RU, transcript variant U (Dscam), mRNA 
0   NM_001043018.1  CG17800-RV, transcript variant V (Dscam), mRNA 
0   NM_206047.1  CG17800-RE, transcript variant E (Dscam), mRNA 
0   NM_001043056.1  CG17800-RW, transcript variant W (Dscam), mRNA 
0   NM_001043030.1  CG17800-RX, transcript variant X (Dscam), mRNA 
0   NM_001043026.1  CG17800-RY, transcript variant Y (Dscam), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.