National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 6284R-2 
 Symbol Sirt6  Full Name Sirt6 
 CG No CG6284  Old CG No CG6284 
 Synonyms dmSRT408, CG6284, dSIRT6, D.mel4, Sirt6 
 Accession No (Link to NCBI) NM_141733.1 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees abnormal wing 
 Map Viewer
[Please submit your publication]
Kusama S, Ueda R, Suda T, Nishihara S, Matsuura ET.
Involvement of Drosophila Sir2-like genes in the regulation of life span.
Genes Genet. Syst. (2006) 81(5) 341-8 [ PubMed ID = 17159295 ] [ RRC reference ]  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
 Primer Seq. 3'
 Predicted Fragment Size
 IR fragment full Seq
 in silico PCR Fragment
 Assemble Data

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     1   ACTACGCGGATGGATTGTCAGCCTACGACAACAAGGGAATTTTGGGAGCACCAGAGAGTT 60

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     61  TCGACAGCGATGAGGTTGTGGCCGAAAAGTGCCAGGAATTGGCTGAATTGATCAAGAAAT 120

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     121 CGGGACACGTTGTCCTCCACACGGGAGCTGGGATCAGTACGTCTGCAGGAATTCCGGATT 180

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     181 TCCGCGGACCCAAGGGCGTTTGGACCCTGGAGGAGAAGGGCGAGAAGCCGGACTTCAATG 240

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     241 TTTCCTTCGATGAAGCCAGACCAACTAAAACCCACATGGCTATCATAGCCCTGATTGAAA 300

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     301 GTGGCTATGTGCAGTACGTAATCTCACAGAATATTGATGGTCTCCACTTGAAATCCGGAC 360

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     361 TGGATCGGAAGTATCTTTCCGAATTGCACGGCAACATTTACATCGAACAGTGTAAGAAAT 420

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     421 GCAGACGGCAATTTGTGAGCCCATCTGCCGTGGAAACAGTGGGTCAAAAATCCCTGCAAC 480

                          |||||||||||||||||||||||||||||||||||||||||||||| silico     481 GTGCCTGCAAGTCTTCAATGGATAGCAAAGGTCGTAGCTGTAGATC 526

 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   508  NM_141733.1  CG6284-RA (Sirt6), mRNA 
0.19   NM_135491.2  CG31755-RA (CG31755), mRNA 
0   NM_140963.1  CG5847-RA (CG5847), mRNA 
0   NM_080325.3  CG6450-RC (lva), mRNA 
0   NM_001043040.1  CG17800-PAJ (Dscam), mRNA 
0   NM_001043041.1  CG17800-PBE (Dscam), mRNA 
0   NM_001043045.1  CG17800-PAK (Dscam), mRNA 
0   NM_001043014.1  CG17800-PAL (Dscam), mRNA 
0   NM_001043057.1  CG17800-PAM (Dscam), mRNA 
0   NM_001043038.1  CG17800-PAN (Dscam), mRNA 
0   NM_001043059.1  CG17800-PAO (Dscam), mRNA 
0   NM_001043051.1  CG17800-PAP (Dscam), mRNA 
0   NM_001043023.1  CG17800-PAQ (Dscam), mRNA 
0   NM_001043027.1  CG17800-PAR (Dscam), mRNA 
0   NM_001043019.1  CG17800-PAS (Dscam), mRNA 
0   NM_078925.5  CG17800-RD, transcript variant D (Dscam), mRNA 
0   NM_001043021.1  CG17800-PAT (Dscam), mRNA 
0   NM_001043037.1  CG17800-PAU (Dscam), mRNA 
0   NM_001043039.1  CG17800-PAV (Dscam), mRNA 
0   NM_001043017.1  CG17800-PAW (Dscam), mRNA 
0   NM_001043015.1  CG17800-PAX (Dscam), mRNA 
0   NM_001043032.1  CG17800-PAY (Dscam), mRNA 
0   NM_001043024.1  CG17800-PBC (Dscam), mRNA 
0   NM_001043035.1  CG17800-RT, transcript variant T (Dscam), mRNA 
0   NM_001043046.1  CG17800-RU, transcript variant U (Dscam), mRNA 
0   NM_001043018.1  CG17800-RV, transcript variant V (Dscam), mRNA 
0   NM_206047.1  CG17800-RE, transcript variant E (Dscam), mRNA 
0   NM_001043056.1  CG17800-RW, transcript variant W (Dscam), mRNA 
0   NM_001043030.1  CG17800-RX, transcript variant X (Dscam), mRNA 
0   NM_001043026.1  CG17800-RY, transcript variant Y (Dscam), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.