National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  

Suspension of shipments during Golden Week Holidays: From 4 May to 11 May, deadline 21 April.

NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 6223R-2 
 Symbol betaCop  Full Name beta-coatomer protein 
 CG No CG6223  Old CG No CG6223 
 Synonyms beta-COP, betaCOP, BetaCop, beta-Cop, beta-CopII, BcDNA.GH09317, bcop, betaCop, CG6223, BcDNA:GH09317 
 Accession No (Link to NCBI)  
 Inserted Chr. ll 
 Insertional Mutation  lethal 
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
[Please submit your publication]
Ito S, Ueda T, Ueno A, Nakagawa H, Taniguchi H, Kayukawa N, Miki T.
A genetic screen in Drosophila for regulators of human prostate cancer progression.
Biochem Biophys Res Commun (2014) 451(4) 548-55 [ PubMed ID = 25117438 ] [ RRC reference ]

Ohhara Y, Nakamura A, Kato Y, Yamakawa-Kobayashi K.
Chaperonin TRiC/CCT supports mitotic exit and entry into endocycle in Drosophila.
PLoS Genet (2019) 15(4) e1008121 [ PubMed ID = 31034473 ] [ RRC reference ]  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
 Primer Seq. 3'
 Predicted Fragment Size
 IR fragment full Seq
 in silico PCR Fragment
 Assemble Data

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     1   ATGACGTCGCAAGTGCCGTGCTACACGATAATCAACTCGCCGGACCTGGAGGTGACCAAC 60

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     61  GAGATGCAACTGAAGCGCGATCTCGAAAAGGGCGACACGAACGTGAAGATCGAGACGCTG 120

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     121 AAGCGGGTAATCAAGTTGCTGCTGAATGGGGAGCGGTATCCGGGCCTGATCATGACCATC 180

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     181 ATACGCTTCGTCCTGCCGGTGCAGAACCACACGATCAAGAAGCTGCTGCTCATCTTCTGG 240

                          ||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| silico     241 GAAATTGTGCCGAAGACATCGGCGGATGGGAAGCTGCTGCAGGAGATGATACTGGTGTGC 300

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     301 GATGCGTACAGGAAGGATTTGCAGCATCCCAATGAGTTTCTGCGCGGCTCGACACTGCGC 360

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     361 TTCCTCTGCAAGCTGAAGGAGCCGGAGCTGCTGGAGCCACTGATGCCGGCCATACGGGCG 420

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     421 TGCCTGGATCACCGGCACTCGTATGTGCGACGAAATGCCGTGCTGGCCATCTTTACCATC 480

                          ||||||||||||||||||||||||| silico     481 TACAAGAACTTCGATTGGCTGGTGCC 506

 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.