National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 6223R-2 
 Symbol betaCop  Full Name beta-coatomer protein 
 CG No CG6223  Old CG No CG6223 
 Synonyms beta-COP, betaCOP, BetaCop, beta-Cop, beta-CopII, BcDNA.GH09317, bcop, betaCop, CG6223, BcDNA:GH09317 
 Accession No (Link to NCBI)  
 Inserted Chr. ll 
 Insertional Mutation  lethal 
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
 Reference
[Please submit your publication]
Ito S, Ueda T, Ueno A, Nakagawa H, Taniguchi H, Kayukawa N, Miki T.
A genetic screen in Drosophila for regulators of human prostate cancer progression.
Biochem. Biophys. Res. Commun. (2014) 451(4) 548-55 [ PubMed ID = 25117438 ] [ RRC reference ]

Ohhara Y, Nakamura A, Kato Y, Yamakawa-Kobayashi K.
Chaperonin TRiC/CCT supports mitotic exit and entry into endocycle in Drosophila.
PLoS Genet. (2019) 15(4) e1008121 [ PubMed ID = 31034473 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgATGACGTCGCAAGTGCCGTGC 
 Primer Seq. 3'
aatctagaggtaccGGCACCAGCCAATCGAAGTTC 
 Predicted Fragment Size
506 
 IR fragment full Seq
0001 ATGACGTCGC AAGTGCCGTG CTACACGATA ATCAACTCGC CGGACCTGGA GGTGACCAAC 
0061 GAGATGCAAC TGAAGCGCGA TCTCGAAAAG GGCGACACGA ACGTGAAGAT CGAGACGCTG 
0121 AAGCGGGTAA TCAAGTTGCT GCTGAATGGG GAGCGGTATC CGGGCCTGAT CATGACCATC 
0181 ATACGCTTCG TCCTGCCGGT GCAGAACCAC ACGATCAAGA AGCTGCTGCT CATCTTCTGG 
0241 GAAATTGTGC CGAAGACATC GGCGGATGGG AAGCTGCTGC AAGAGATGAT ACTGGTGTGC 
0301 GATGCGTACA GGAAGGATTT GCAGCATCCC AATGAGTTTC TGCGCGGCTC GACACTGCGC 
0361 TTCCTCTGCA AGCTGAAGGA GCCGGAGCTG CTGGAGCCAC TGATGCCGGC CATACGGGCG 
0421 TGCCTGGATC ACCGGCACTC GTATGTGCGA CGAAATGCCG TGCTGGCCAT CTTTACCATC 
0481 TACAAGAACT TCGATTGGCT GGTGCN 
 in silico PCR Fragment
0001 ATGACGTCGC AAGTGCCGTG CTACACGATA ATCAACTCGC CGGACCTGGA GGTGACCAAC 
0061 GAGATGCAAC TGAAGCGCGA TCTCGAAAAG GGCGACACGA ACGTGAAGAT CGAGACGCTG 
0121 AAGCGGGTAA TCAAGTTGCT GCTGAATGGG GAGCGGTATC CGGGCCTGAT CATGACCATC 
0181 ATACGCTTCG TCCTGCCGGT GCAGAACCAC ACGATCAAGA AGCTGCTGCT CATCTTCTGG 
0241 GAAATTGTGC CGAAGACATC GGCGGATGGG AAGCTGCTGC AGGAGATGAT ACTGGTGTGC 
0301 GATGCGTACA GGAAGGATTT GCAGCATCCC AATGAGTTTC TGCGCGGCTC GACACTGCGC 
0361 TTCCTCTGCA AGCTGAAGGA GCCGGAGCTG CTGGAGCCAC TGATGCCGGC CATACGGGCG 
0421 TGCCTGGATC ACCGGCACTC GTATGTGCGA CGAAATGCCG TGCTGGCCAT CTTTACCATC 
0481 TACAAGAACT TCGATTGGCT GGTGCC 
 Assemble Data

6223R-2.IR full       1   ATGACGTCGCAAGTGCCGTGCTACACGATAATCAACTCGCCGGACCTGGAGGTGACCAAC 60
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
6223R-2.in silico     1   ATGACGTCGCAAGTGCCGTGCTACACGATAATCAACTCGCCGGACCTGGAGGTGACCAAC 60


6223R-2.IR full       61  GAGATGCAACTGAAGCGCGATCTCGAAAAGGGCGACACGAACGTGAAGATCGAGACGCTG 120
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
6223R-2.in silico     61  GAGATGCAACTGAAGCGCGATCTCGAAAAGGGCGACACGAACGTGAAGATCGAGACGCTG 120


6223R-2.IR full       121 AAGCGGGTAATCAAGTTGCTGCTGAATGGGGAGCGGTATCCGGGCCTGATCATGACCATC 180
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
6223R-2.in silico     121 AAGCGGGTAATCAAGTTGCTGCTGAATGGGGAGCGGTATCCGGGCCTGATCATGACCATC 180


6223R-2.IR full       181 ATACGCTTCGTCCTGCCGGTGCAGAACCACACGATCAAGAAGCTGCTGCTCATCTTCTGG 240
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
6223R-2.in silico     181 ATACGCTTCGTCCTGCCGGTGCAGAACCACACGATCAAGAAGCTGCTGCTCATCTTCTGG 240


6223R-2.IR full       241 GAAATTGTGCCGAAGACATCGGCGGATGGGAAGCTGCTGCAAGAGATGATACTGGTGTGC 300
                          ||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||
6223R-2.in silico     241 GAAATTGTGCCGAAGACATCGGCGGATGGGAAGCTGCTGCAGGAGATGATACTGGTGTGC 300


6223R-2.IR full       301 GATGCGTACAGGAAGGATTTGCAGCATCCCAATGAGTTTCTGCGCGGCTCGACACTGCGC 360
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
6223R-2.in silico     301 GATGCGTACAGGAAGGATTTGCAGCATCCCAATGAGTTTCTGCGCGGCTCGACACTGCGC 360


6223R-2.IR full       361 TTCCTCTGCAAGCTGAAGGAGCCGGAGCTGCTGGAGCCACTGATGCCGGCCATACGGGCG 420
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
6223R-2.in silico     361 TTCCTCTGCAAGCTGAAGGAGCCGGAGCTGCTGGAGCCACTGATGCCGGCCATACGGGCG 420


6223R-2.IR full       421 TGCCTGGATCACCGGCACTCGTATGTGCGACGAAATGCCGTGCTGGCCATCTTTACCATC 480
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
6223R-2.in silico     421 TGCCTGGATCACCGGCACTCGTATGTGCGACGAAATGCCGTGCTGGCCATCTTTACCATC 480


6223R-2.IR full       481 TACAAGAACTTCGATTGGCTGGTGCN 506
                          ||||||||||||||||||||||||| 
6223R-2.in silico     481 TACAAGAACTTCGATTGGCTGGTGCC 506

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.