National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 6141R-1 
 Symbol RpL9  Full Name Ribosomal protein L9 
 CG No CG6141  Old CG No CG6141 
 Synonyms L9, rpL9, unnamed, M(2)32D, anon-EST:fe3A6, CG6141, anon-WO0153538.27, anon-WO0153538.26, anon-WO0153538.25, RpL9, Rpl9 
 Accession No (Link to NCBI) NM_057813.3 
 Inserted Chr. lll 
 Insertional Mutation  lethal 
 Phenotype induced by Act5C-GAL4 at 28 degrees viable 
 Map Viewer
 Reference
[Please submit your publication]
Akai N, Igaki T, Ohsawa S.
Wingless signaling regulates winner/loser status in Minute cell competition.
Genes Cells (2018) 23(3) 234-240 [ PubMed ID = 29431244 ] [ RRC reference ]

Ohhara Y, Nakamura A, Kato Y, Yamakawa-Kobayashi K.
Chaperonin TRiC/CCT supports mitotic exit and entry into endocycle in Drosophila.
PLoS Genet. (2019) 15(4) e1008121 [ PubMed ID = 31034473 ] [ RRC reference ]

Tiwari P, Kumar A, Das RN, Malhotra V, VijayRaghavan K.
A Tendon Cell Specific RNAi Screen Reveals Novel Candidates Essential for Muscle Tendon Interaction.
PLoS ONE (2015) 10(10) e0140976 [ PubMed ID = 26488612 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgCCTAAGGATATCAAGGCCTCG 
 Primer Seq. 3'
aatctagaggtaccACGTACAGACCGTCAAGGAAC 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 CCTAAGGATA TCAAGGCCTC GGTGAAGGCC CGTGTGGTGA CCATCACCGG CACCCGCGGC 
0061 ACCCTGAAGC GCAGCTTCAA GCACTTGGCT CTGGACATGT ACATGCCCGA CAAGCGCACC 
0121 CTGAAGGTGG AGAAGTGGTT CGGAACCAAG AAGGAGTTGG CCGCCGTCCG CACCGTCTGC 
0181 AGTCACATCG AGAACATGAT CAAGGGAGTC ACGTTTGGAT TCCAGTACAA GATGCGTGCT 
0241 GTGTACGCCC ATTTCCCCAT CAACTGTGTC ACCTCCGAGA ACAACACGGT CATTGAGATC 
0301 CGTAACTTCT TGGGTGAGAA GTACATCCGT CGTGTGGAGA TGGCTCCTGG CGTCACCGTG 
0361 GTCAACTCCA CTGCCCAGAA GGACGAACTT ATCGTGGAGG GAAACGATAT TGAGTCTGTC 
0421 TCCGGATCTG CCGCCCTCAT CCAGCAGTCC ACGACCGTCA AGAACAAGGA TATCCGTAAG 
0481 TTCCTTGACG GTCTGTACGT  
 in silico PCR Fragment
0001 CCTAAGGATA TCAAGGCCTC GGTGAAGGCC CGTGTGGTGA CCATCACCGG CACCCGCGGC 
0061 ACCCTGAAGC GCAGCTTCAA GCACTTGGCT CTGGACATGT ACATGCCCGA CAAGCGCACC 
0121 CTGAAGGTGG AGAAGTGGTT CGGAACCAAG AAGGAGTTGG CCGCCGTCCG CACCGTCTGC 
0181 AGTCACATCG AGAACATGAT CAAGGGAGTC ACGTTTGGAT TCCAGTACAA GATGCGTGCT 
0241 GTGTACGCCC ATTTCCCCAT CAACTGTGTC ACCTCCGAGA ACAACACGGT CATTGAGATC 
0301 CGTAACTTCT TGGGTGAGAA GTACATCCGT CGTGTGGAGA TGGCTCCTGG CGTCACCGTG 
0361 GTCAACTCCA CTGCCCAGAA GGACGAACTT ATCGTGGAGG GAAACGATAT TGAGTCTGTC 
0421 TCCGGATCTG CCGCCCTCAT CCAGCAGTCC ACGACCGTCA AGAACAAGGA TATCCGTAAG 
0481 TTCCTTGACG GTCTGTACGT  
 Assemble Data

6141R-1.IR_full       1   CCTAAGGATATCAAGGCCTCGGTGAAGGCCCGTGTGGTGACCATCACCGGCACCCGCGGC 60
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
6141R-1.in silico     1   CCTAAGGATATCAAGGCCTCGGTGAAGGCCCGTGTGGTGACCATCACCGGCACCCGCGGC 60


6141R-1.IR_full       61  ACCCTGAAGCGCAGCTTCAAGCACTTGGCTCTGGACATGTACATGCCCGACAAGCGCACC 120
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
6141R-1.in silico     61  ACCCTGAAGCGCAGCTTCAAGCACTTGGCTCTGGACATGTACATGCCCGACAAGCGCACC 120


6141R-1.IR_full       121 CTGAAGGTGGAGAAGTGGTTCGGAACCAAGAAGGAGTTGGCCGCCGTCCGCACCGTCTGC 180
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
6141R-1.in silico     121 CTGAAGGTGGAGAAGTGGTTCGGAACCAAGAAGGAGTTGGCCGCCGTCCGCACCGTCTGC 180


6141R-1.IR_full       181 AGTCACATCGAGAACATGATCAAGGGAGTCACGTTTGGATTCCAGTACAAGATGCGTGCT 240
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
6141R-1.in silico     181 AGTCACATCGAGAACATGATCAAGGGAGTCACGTTTGGATTCCAGTACAAGATGCGTGCT 240


6141R-1.IR_full       241 GTGTACGCCCATTTCCCCATCAACTGTGTCACCTCCGAGAACAACACGGTCATTGAGATC 300
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
6141R-1.in silico     241 GTGTACGCCCATTTCCCCATCAACTGTGTCACCTCCGAGAACAACACGGTCATTGAGATC 300


6141R-1.IR_full       301 CGTAACTTCTTGGGTGAGAAGTACATCCGTCGTGTGGAGATGGCTCCTGGCGTCACCGTG 360
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
6141R-1.in silico     301 CGTAACTTCTTGGGTGAGAAGTACATCCGTCGTGTGGAGATGGCTCCTGGCGTCACCGTG 360


6141R-1.IR_full       361 GTCAACTCCACTGCCCAGAAGGACGAACTTATCGTGGAGGGAAACGATATTGAGTCTGTC 420
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
6141R-1.in silico     361 GTCAACTCCACTGCCCAGAAGGACGAACTTATCGTGGAGGGAAACGATATTGAGTCTGTC 420


6141R-1.IR_full       421 TCCGGATCTGCCGCCCTCATCCAGCAGTCCACGACCGTCAAGAACAAGGATATCCGTAAG 480
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
6141R-1.in silico     421 TCCGGATCTGCCGCCCTCATCCAGCAGTCCACGACCGTCAAGAACAAGGATATCCGTAAG 480


6141R-1.IR_full       481 TTCCTTGACGGTCTGTACGT 500
                          ||||||||||||||||||||
6141R-1.in silico     481 TTCCTTGACGGTCTGTACGT 500

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_057813.3  CG6141-RA, transcript variant A (RpL9), mRNA 
100   482  NM_164955.1  CG6141-RB, transcript variant B (RpL9), mRNA 
0.2   NM_140035.1  CG4484-RA (CG4484), mRNA 
0   NM_143796.2  CG12770-RA (Vps28), mRNA 
0   NM_079959.2  CG4501-RA (bgm), mRNA 
0   NM_078801.4  CG4405-RA, transcript variant A (jp), mRNA 
0   NM_164858.1  CG4405-RB, transcript variant B (jp), mRNA 
0   NM_137999.2  CG5602-RA (CG5602), mRNA 
0   NM_137566.2  CG9834-RA, transcript variant A (endoB), mRNA 
0   NM_166340.1  CG9834-RB, transcript variant B (endoB), mRNA 
0   NM_079736.2  CG10868-RA, transcript variant A (orb), mRNA 
0   NM_170062.1  CG10868-RB, transcript variant B (orb), mRNA 
0   NM_170063.2  CG10868-RD, transcript variant D (orb), mRNA 
0   NM_137621.2  CG10444-RA (CG10444), mRNA 
0   NM_135328.1  CG7219-RA (CG7219), mRNA 
0   NM_137955.1  CG13556-RA (CG13556), mRNA 
0   NM_080765.2  CG13777-RC, transcript variant C (milt), mRNA 
0   NM_164736.1  CG13777-RA, transcript variant A (milt), mRNA 
0   NM_164738.1  CG13777-RB, transcript variant B (milt), mRNA 
0   NM_140093.1  CG18178-RA (CG18178), mRNA 
0   NM_079017.2  CG8542-RA (Hsc70-5), mRNA 
0   NM_079218.2  CG10491-RA, transcript variant A (vn), mRNA 
0   NM_001014565.1  CG10491-RB, transcript variant B (vn), mRNA 
0   NM_079175.2  CG1242-RA (Hsp83), mRNA 
0   NM_001043014.1  CG17800-PAL (Dscam), mRNA 
0   NM_170354.1  CG12428-RE, transcript variant E (CG12428), mRNA 
0   NM_170353.1  CG12428-RD, transcript variant D (CG12428), mRNA 
0   NM_170351.1  CG12428-RA, transcript variant A (CG12428), mRNA 
0   NM_143326.2  CG12428-RC, transcript variant C (CG12428), mRNA 
0   NM_170352.1  CG12428-RB, transcript variant B (CG12428), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.