National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock temporarily unavailable request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 6141R-1 
 Symbol RpL9  Full Name Ribosomal protein L9 
 CG No CG6141  Old CG No CG6141 
 Synonyms L9, rpL9, unnamed, M(2)32D, anon-EST:fe3A6, CG6141, anon-WO0153538.27, anon-WO0153538.26, anon-WO0153538.25, RpL9, Rpl9 
 Accession No (Link to NCBI) NM_057813.3 
 Inserted Chr. lll 
 Insertional Mutation  lethal 
 Phenotype induced by Act5C-GAL4 at 28 degrees viable 
 Map Viewer
[Please submit your publication]
Akai N, Igaki T, Ohsawa S.
Wingless signaling regulates winner/loser status in Minute cell competition.
Genes Cells (2018) 23(3) 234-240 [ PubMed ID = 29431244 ] [ RRC reference ]

Ohhara Y, Nakamura A, Kato Y, Yamakawa-Kobayashi K.
Chaperonin TRiC/CCT supports mitotic exit and entry into endocycle in Drosophila.
PLoS Genet. (2019) 15(4) e1008121 [ PubMed ID = 31034473 ] [ RRC reference ]

Tiwari P, Kumar A, Das RN, Malhotra V, VijayRaghavan K.
A Tendon Cell Specific RNAi Screen Reveals Novel Candidates Essential for Muscle Tendon Interaction.
PLoS ONE (2015) 10(10) e0140976 [ PubMed ID = 26488612 ] [ RRC reference ]  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
 Primer Seq. 3'
 Predicted Fragment Size
 IR fragment full Seq
 in silico PCR Fragment
 Assemble Data

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     1   CCTAAGGATATCAAGGCCTCGGTGAAGGCCCGTGTGGTGACCATCACCGGCACCCGCGGC 60

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     61  ACCCTGAAGCGCAGCTTCAAGCACTTGGCTCTGGACATGTACATGCCCGACAAGCGCACC 120

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     121 CTGAAGGTGGAGAAGTGGTTCGGAACCAAGAAGGAGTTGGCCGCCGTCCGCACCGTCTGC 180

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     181 AGTCACATCGAGAACATGATCAAGGGAGTCACGTTTGGATTCCAGTACAAGATGCGTGCT 240

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     241 GTGTACGCCCATTTCCCCATCAACTGTGTCACCTCCGAGAACAACACGGTCATTGAGATC 300

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     301 CGTAACTTCTTGGGTGAGAAGTACATCCGTCGTGTGGAGATGGCTCCTGGCGTCACCGTG 360

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     361 GTCAACTCCACTGCCCAGAAGGACGAACTTATCGTGGAGGGAAACGATATTGAGTCTGTC 420

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     421 TCCGGATCTGCCGCCCTCATCCAGCAGTCCACGACCGTCAAGAACAAGGATATCCGTAAG 480

6141R-1.IR_full       481 TTCCTTGACGGTCTGTACGT 500
                          |||||||||||||||||||| silico     481 TTCCTTGACGGTCTGTACGT 500

 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_057813.3  CG6141-RA, transcript variant A (RpL9), mRNA 
100   482  NM_164955.1  CG6141-RB, transcript variant B (RpL9), mRNA 
0.2   NM_140035.1  CG4484-RA (CG4484), mRNA 
0   NM_143796.2  CG12770-RA (Vps28), mRNA 
0   NM_079959.2  CG4501-RA (bgm), mRNA 
0   NM_078801.4  CG4405-RA, transcript variant A (jp), mRNA 
0   NM_164858.1  CG4405-RB, transcript variant B (jp), mRNA 
0   NM_137999.2  CG5602-RA (CG5602), mRNA 
0   NM_137566.2  CG9834-RA, transcript variant A (endoB), mRNA 
0   NM_166340.1  CG9834-RB, transcript variant B (endoB), mRNA 
0   NM_079736.2  CG10868-RA, transcript variant A (orb), mRNA 
0   NM_170062.1  CG10868-RB, transcript variant B (orb), mRNA 
0   NM_170063.2  CG10868-RD, transcript variant D (orb), mRNA 
0   NM_137621.2  CG10444-RA (CG10444), mRNA 
0   NM_135328.1  CG7219-RA (CG7219), mRNA 
0   NM_137955.1  CG13556-RA (CG13556), mRNA 
0   NM_080765.2  CG13777-RC, transcript variant C (milt), mRNA 
0   NM_164736.1  CG13777-RA, transcript variant A (milt), mRNA 
0   NM_164738.1  CG13777-RB, transcript variant B (milt), mRNA 
0   NM_140093.1  CG18178-RA (CG18178), mRNA 
0   NM_079017.2  CG8542-RA (Hsc70-5), mRNA 
0   NM_079218.2  CG10491-RA, transcript variant A (vn), mRNA 
0   NM_001014565.1  CG10491-RB, transcript variant B (vn), mRNA 
0   NM_079175.2  CG1242-RA (Hsp83), mRNA 
0   NM_001043014.1  CG17800-PAL (Dscam), mRNA 
0   NM_170354.1  CG12428-RE, transcript variant E (CG12428), mRNA 
0   NM_170353.1  CG12428-RD, transcript variant D (CG12428), mRNA 
0   NM_170351.1  CG12428-RA, transcript variant A (CG12428), mRNA 
0   NM_143326.2  CG12428-RC, transcript variant C (CG12428), mRNA 
0   NM_170352.1  CG12428-RB, transcript variant B (CG12428), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.