National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 6129R-1 
 Symbol CG6129  Full Name CG6129 
 CG No CG6129  Old CG No CG6129 
 Synonyms CG6129 
 Accession No (Link to NCBI) NM_142959.2 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
 Reference
[Please submit your publication]
Balmer S, Dussert A, Collu GM, Benitez E, Iomini C, Mlodzik M.
Components of Intraflagellar Transport Complex A Function Independently of the Cilium to Regulate Canonical Wnt Signaling in Drosophila.
Dev. Cell (2015) 34(6) 705-18 [ PubMed ID = 26364750 ] [ RRC reference ]

Nitta Y, Yamazaki D, Sugie A, Hiroi M, Tabata T.
DISCO Interacting Protein 2 regulates axonal bifurcation and guidance of Drosophila mushroom body neurons.
Dev. Biol. (2017) 421(2) 233-244 [ PubMed ID = 27908785 ] [ RRC reference ]

Umemori M, Habara O, Iwata T, Maeda K, Nishinoue K, Okabe A, Takemura M, Takahashi K, Saigo K, Ueda R, Adachi-Yamada T.
RNAi-mediated knockdown showing impaired cell survival in Drosophila wing imaginal disc.
Gene Regul Syst Bio (2009) 3 11-20 [ PubMed ID = 19838331 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgGTTGCTGGTGGTCTAACGCCC 
 Primer Seq. 3'
aatctagaggtaccTCCTCCAGTTTGCGGCACAGT 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 GTTGCTGGTG GTCTAACGCC CAGGATGATG AGTCCGGGTC CGCCGGGCGC CGgaGGAGGA 
0061 GGAGGAGGAG GAGTGAGCGG CgGCGGCAGT GGAGATCNCC TCGGCCHTNG TTGCGCCAGA 
0121 TATCAGGAGC TGCGCCAACG GCTCGGCCGA CGAGTCGCAT AGCTATCCGA CGCCGCCTGG 
0181 ACACCTACAA CGCAGGCGCA GCACAACCAG GCCAACTTGG TCAGCCGGCT GCAGTCGAAG 
0241 ATCCAGCAGT ATCGACAGCG GATGTAGCGA CCTGGAGGAT CGCATGCACG AGACCATTAA 
0301 GCCGACGGCG GGAGTAGGAC CCAAGCTGAC CACGGGTCCC ACCAACCAAG TGCTGTGTTC 
0361 AACTTCTTTA ACTCTGGGAC AGAGCAGCTT GCCCTGCAGC TCCTCACTGG ACTCGCCGCC 
0421 GCCCAGTTGC AGTCGTGACT ATGTTGACGA TGTCTTGGTC ACCGGAGGCG GCGcCGGTGC 
0481 GGCCGGAACT GTGCCGCAAA CTGGAGGA 
 in silico PCR Fragment
0001 GTTGCTGGTG GTCTAACGCC CAGGATGATG AGTCCGGGTC CGCCGGGCGC CGGAGGAGGA 
0061 GGAGGAGGAG GAGTGAGCGG CGGCGGCAGT GGAGATC-CC TCGGCCCT-G TTGCGCCAGA 
0121 -ATCAGGAGC TGCGCCAACG GCT-GGCCGA CGAGTCGCAT AGCTAT-CGA CGCCGCCTGG 
0181 ACACCTACAA -GCAGGCGCA GCACAACCAG GCCAACTTGG TCAGCCGGCT GCAGTCGAAG 
0241 ATCCAGCAGT ATCGACAGCG G-TGTAGCGA CCTGGAGGAG CGCATGCACG AGACCATTAA 
0301 GCCGACGGCG GGAGTAGGAC CCAAGCTGAC CACGGGTCCC ACCAACCAAG TGCTGTGTTC 
0361 AACTTCTTTA ACTCTGGGAC AGAGCAGCTT GCCCTGCAGC TCCTCACTGG ACTCGCCGCC 
0421 GCCCAGTTGC AGTCGTGACT ATGTTGACGA TGTCTTGGTC ACCGGAGGCG GCGCCGGTGC 
0481 GG-CGGAACT GTGCCGCAAA CTGGAGGA 
 Assemble Data

6129R-1.IR_full       1   GTTGCTGGTGGTCTAACGCCCAGGATGATGAGTCCGGGTCCGCCGGGCGCCGGAGGAGGA 60
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
6129R-1.in silico     1   GTTGCTGGTGGTCTAACGCCCAGGATGATGAGTCCGGGTCCGCCGGGCGCCGGAGGAGGA 60


6129R-1.IR_full       61  GGAGGAGGAGGAGTGAGCGGCGGCGGCAGTGGAGATCNCCTCGGCCHTNGTTGCGCCAGA 120
                          ||||||||||||||||||||||||||||||||||||| |||||||| | |||||||||||
6129R-1.in silico     61  GGAGGAGGAGGAGTGAGCGGCGGCGGCAGTGGAGATC-CCTCGGCCCT-GTTGCGCCAGA 120


6129R-1.IR_full       121 TATCAGGAGCTGCGCCAACGGCTCGGCCGACGAGTCGCATAGCTATCCGACGCCGCCTGG 180
                           |||||||||||||||||||||| |||||||||||||||||||||| |||||||||||||
6129R-1.in silico     121 -ATCAGGAGCTGCGCCAACGGCT-GGCCGACGAGTCGCATAGCTAT-CGACGCCGCCTGG 180


6129R-1.IR_full       181 ACACCTACAACGCAGGCGCAGCACAACCAGGCCAACTTGGTCAGCCGGCTGCAGTCGAAG 240
                          |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||
6129R-1.in silico     181 ACACCTACAA-GCAGGCGCAGCACAACCAGGCCAACTTGGTCAGCCGGCTGCAGTCGAAG 240


6129R-1.IR_full       241 ATCCAGCAGTATCGACAGCGGATGTAGCGACCTGGAGGATCGCATGCACGAGACCATTAA 300
                          ||||||||||||||||||||| ||||||||||||||||| ||||||||||||||||||||
6129R-1.in silico     241 ATCCAGCAGTATCGACAGCGG-TGTAGCGACCTGGAGGAGCGCATGCACGAGACCATTAA 300


6129R-1.IR_full       301 GCCGACGGCGGGAGTAGGACCCAAGCTGACCACGGGTCCCACCAACCAAGTGCTGTGTTC 360
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
6129R-1.in silico     301 GCCGACGGCGGGAGTAGGACCCAAGCTGACCACGGGTCCCACCAACCAAGTGCTGTGTTC 360


6129R-1.IR_full       361 AACTTCTTTAACTCTGGGACAGAGCAGCTTGCCCTGCAGCTCCTCACTGGACTCGCCGCC 420
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
6129R-1.in silico     361 AACTTCTTTAACTCTGGGACAGAGCAGCTTGCCCTGCAGCTCCTCACTGGACTCGCCGCC 420


6129R-1.IR_full       421 GCCCAGTTGCAGTCGTGACTATGTTGACGATGTCTTGGTCACCGGAGGCGGCGCCGGTGC 480
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
6129R-1.in silico     421 GCCCAGTTGCAGTCGTGACTATGTTGACGATGTCTTGGTCACCGGAGGCGGCGCCGGTGC 480


6129R-1.IR_full       481 GGCCGGAACTGTGCCGCAAACTGGAGGA 508
                          || |||||||||||||||||||||||||
6129R-1.in silico     481 GG-CGGAACTGTGCCGCAAACTGGAGGA 508

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100.41  484  12  30  NM_142959.2  CG6129-RB, transcript variant B (CG6129), mRNA 
6.43   31  32  37  60  NM_167524.2  CG9819-RB, transcript variant B (CanA-14F), mRNA 
6.43   31  32  37  60  NM_167523.2  CG9819-RA, transcript variant A (CanA-14F), mRNA 
3.52   17  20  29  44  NM_135975.2  CG31781-RB (CG31781), mRNA 
3.52   17  11  14  32  NM_176374.1  CG4761-RA (knrl), mRNA 
3.31   16  22  39  63  NM_170053.2  CG17894-RC, transcript variant C (cnc), mRNA 
3.11   15  14  49  65  NM_133114.2  CG32541-RA (CG32541), mRNA 
2.48   12  20  27  37  NM_057406.3  CG6222-RA (su(s)), mRNA 
2.48   12  12  21  47  NM_167309.1  CG32663-RA (CG32663), mRNA 
2.48   12  12  18  31  NM_135495.2  CG4778-RA (CG4778), mRNA 
2.28   11  17  26  34  NM_141658.3  CG8301-RA (CG8301), mRNA 
2.28   11  15  34  61  NM_133104.2  CG7282-RA (CG7282), mRNA 
2.28   11  15  25  38  NM_135079.4  CG14021-RB, transcript variant B (CG14021), mRNA 
2.28   11  15  25  38  NM_164640.1  CG14021-RA, transcript variant A (CG14021), mRNA 
2.28   11  22  33  NM_166335.2  CG7097-RA, transcript variant A (CG7097), mRNA 
2.07   10  24  28  56  NM_078516.2  CG12690-RA (CHES-1-like), mRNA 
2.07   10  14  20  35  NM_140288.2  CG6801-RA (l(3)j2D3), mRNA 
2.07   10  12  19  36  NM_057368.3  CG2621-RD, transcript variant D (sgg), mRNA 
2.07   10  12  16  26  NM_138057.1  CG13576-RA (CG13576), mRNA 
2.07   10  11  15  30  NM_143222.1  CG14237-RA (CG14237), mRNA 
2.07   10  11  13  25  NM_134510.1  CG12703-RA (CG12703), mRNA 
2.07   10  16  30  NM_164653.1  CG31646-RA (CG31646), mRNA 
1.86   30  48  72  NM_167340.1  CG32648-RA (Pde9), mRNA 
1.65   24  32  65  NM_167620.2  CG32547-RA (CG32547), mRNA 
1.65   15  21  49  NM_136134.4  CG10186-RA, transcript variant A (CG10186), mRNA 
1.65   15  21  49  NM_165306.1  CG10186-RC, transcript variant C (CG10186), mRNA 
1.65   13  25  40  NM_136060.1  CG10348-RA (CG10348), mRNA 
1.65   13  17  31  NM_206764.1  CG4429-RC, transcript variant C (Rbp2), mRNA 
1.65   13  17  30  NM_167522.2  CG4429-RB, transcript variant B (Rbp2), mRNA 
1.65   13  17  30  NM_080220.2  CG4429-RA, transcript variant A (Rbp2), mRNA 
 Wing Disc
GFP
Puc
Caspase
DAPI
Merge
Figure
JNK signal
N
 
DB
+- 
DC
DM
 
VM
 
VB
 
Caspase-3 signal
N
DB
DC
++ 
DM
VM
 
VB
 
Dcompartment   Penetrance
     

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.