National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 6116R-1 
 Symbol CG6116  Full Name CG6116 
 CG No CG6116  Old CG No CG6116 
 Synonyms CG6116 
 Accession No (Link to NCBI) NM_135788.2 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees pupal lethal 
 Map Viewer
 Reference
[Please submit your publication]
Lee G, Liang C, Park G, Jang C, Jung JU, Chung J.
UVRAG is required for organ rotation by regulating Notch endocytosis in Drosophila.
Dev. Biol. (2011) 356(2) 588-97 [ PubMed ID = 21729695 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgAGCCACCCAGCAACTTCGACT 
 Primer Seq. 3'
aatctagaggtaccACGGGGAGGCAAATTGCTCGC 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 AGCCACCCAG CAACTTCGAC TGCGGAACCT TAATAGAATT CAGGGATTCA ATATTGAGTC 
0061 CTGGTCGCAT GAGAAGTCGC TGGAGCTAGA TGATCCGGAT GATGTGCTCC TCTACTACAC 
0121 ACTACACACG GACAAGGCTA GCGAAGCGTT CNTACACCAG CGAAAAGCTG CCGCAGCGTC 
0181 ACCAACAGCA AAAGTGGGCG GAGATTTGTA CGGACGACGA GGCCTGGCGG AAAACCAATG 
0241 CGCAGTGTGT CTGTGTCAAG GTGTGGAAGC ACTATTCGGC GGAAAGAAGA GATGGCCAAC 
0301 CGCCTGAGGT TGAGCAAAGA CATAAGGATG TTTTCGGAAG ATCCCAGTTA ACGCCCAGCA 
0361 GGCTGCCGCG CCCTNCCTGA ACTACTGTTC AGCTGGGGCG TACTACTTCT CCGGCCTTAT 
0421 ACCTCTGTCT CCCCTCACAT TGTCCCAGTG CGGACGAAAT TGCTTGGTCT TTCAATTGAA 
0481 TGGCGAGCAA TTTGCCTCCC CGT 
 in silico PCR Fragment
0001 AGCCACCCAG CAACTTCGAC TGCGGAACCT TAACAGAATT CAGGGATTCA ATATTGAGTC 
0061 CTGGCCGCAT GAGAAGTCGC TGGAGCTAGA TGATCCGGAT GATGTGCTCC TCTACTACAC 
0121 ACTACACACG GACAAGGCTA GCGAAGCGTT C-TACACCAG CGAAAAGCTG CCGCAGCGTC 
0181 ACCAACAGCA AAAGTGGGCG GAGATTTGTA CGGACGACGA GGCCTGGCGG AAAACCAATG 
0241 CGCAGTGTGT CTGTGTCAAG GTGTGGAAGC ACTATTCGGC GGAAAGAAGA GATGGCCAAC 
0301 CGCCTGAGGT TGAGCAAAGA CATAAGGATG TTTTCGGAAG ATCCCAGTTA ACGCCCAGCA 
0361 GGCTGCCACG CCCT-CCTGA ACTACTGTTC AGCTGGGGCG T-CTACTTCT CCGGCCTTAT 
0421 ACCTCTGTCT CCCCTCACAT TGTCCCAGTG CGGACGAAAT TGCTTGGTCT TTCAATTGAA 
0481 TGGCGAGCAA TTTGCCTCCC CGT 
 Assemble Data

6116R-1.IR_full       1   AGCCACCCAGCAACTTCGACTGCGGAACCTTAATAGAATTCAGGGATTCAATATTGAGTC 60
                          ||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||
6116R-1.in silico     1   AGCCACCCAGCAACTTCGACTGCGGAACCTTAACAGAATTCAGGGATTCAATATTGAGTC 60


6116R-1.IR_full       61  CTGGTCGCATGAGAAGTCGCTGGAGCTAGATGATCCGGATGATGTGCTCCTCTACTACAC 120
                          |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||
6116R-1.in silico     61  CTGGCCGCATGAGAAGTCGCTGGAGCTAGATGATCCGGATGATGTGCTCCTCTACTACAC 120


6116R-1.IR_full       121 ACTACACACGGACAAGGCTAGCGAAGCGTTCNTACACCAGCGAAAAGCTGCCGCAGCGTC 180
                          ||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||
6116R-1.in silico     121 ACTACACACGGACAAGGCTAGCGAAGCGTTC-TACACCAGCGAAAAGCTGCCGCAGCGTC 180


6116R-1.IR_full       181 ACCAACAGCAAAAGTGGGCGGAGATTTGTACGGACGACGAGGCCTGGCGGAAAACCAATG 240
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
6116R-1.in silico     181 ACCAACAGCAAAAGTGGGCGGAGATTTGTACGGACGACGAGGCCTGGCGGAAAACCAATG 240


6116R-1.IR_full       241 CGCAGTGTGTCTGTGTCAAGGTGTGGAAGCACTATTCGGCGGAAAGAAGAGATGGCCAAC 300
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
6116R-1.in silico     241 CGCAGTGTGTCTGTGTCAAGGTGTGGAAGCACTATTCGGCGGAAAGAAGAGATGGCCAAC 300


6116R-1.IR_full       301 CGCCTGAGGTTGAGCAAAGACATAAGGATGTTTTCGGAAGATCCCAGTTAACGCCCAGCA 360
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
6116R-1.in silico     301 CGCCTGAGGTTGAGCAAAGACATAAGGATGTTTTCGGAAGATCCCAGTTAACGCCCAGCA 360


6116R-1.IR_full       361 GGCTGCCGCGCCCTNCCTGAACTACTGTTCAGCTGGGGCGTACTACTTCTCCGGCCTTAT 420
                          ||||||| |||||| |||||||||||||||||||||||||| ||||||||||||||||||
6116R-1.in silico     361 GGCTGCCACGCCCT-CCTGAACTACTGTTCAGCTGGGGCGT-CTACTTCTCCGGCCTTAT 420


6116R-1.IR_full       421 ACCTCTGTCTCCCCTCACATTGTCCCAGTGCGGACGAAATTGCTTGGTCTTTCAATTGAA 480
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
6116R-1.in silico     421 ACCTCTGTCTCCCCTCACATTGTCCCAGTGCGGACGAAATTGCTTGGTCTTTCAATTGAA 480


6116R-1.IR_full       481 TGGCGAGCAATTTGCCTCCCCGT 503
                          |||||||||||||||||||||||
6116R-1.in silico     481 TGGCGAGCAATTTGCCTCCCCGT 503

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_135788.2  CG6116-RA (CG6116), mRNA 
0   NM_166297.1  CG5327-RA (CG5327), mRNA 
0   NM_137504.1  CG5493-RA (CG5493), mRNA 
0   20  NM_001032051.1  CG33715-RD, transcript variant D (Msp-300), mRNA 
0   NM_001032053.1  CG33715-RB, transcript variant B (Msp-300), mRNA 
0   NM_138098.2  CG3565-RA (CG3565), mRNA 
0   NM_137709.2  CG9418-RA (CG9418), mRNA 
0   NM_136238.2  CG9264-RA, transcript variant A (CG9264), mRNA 
0   NM_078726.2  CG4385-RB, transcript variant B (S), mRNA 
0   NM_164403.1  CG4385-RA, transcript variant A (S), mRNA 
0   NM_169245.2  CG31349-RA, transcript variant A (pyd), mRNA 
0   NM_206380.1  CG16838-RD, transcript variant D (CG16838), mRNA 
0   NM_206381.1  CG16838-RC, transcript variant C (CG16838), mRNA 
0   NM_136159.2  CG10466-RA (CG10466), mRNA 
0   NM_137707.2  CG30388-RA (Magi), mRNA 
0   NM_141309.2  CG2244-RB, transcript variant B (MTA1-like), mRNA 
0   NM_169086.1  CG2244-RA, transcript variant A (MTA1-like), mRNA 
0   NM_141731.1  CG3996-RA (CG3996), mRNA 
0   NM_142648.2  CG5494-RA (CG5494), mRNA 
0   NM_142983.2  CG6356-RA (CG6356), mRNA 
0   NM_169134.1  CG31556-RA (CG31556), mRNA 
0   NM_144350.1  CG7487-RA (RecQ4), mRNA 
0   NM_170119.1  CG5422-RD, transcript variant D (Rox8), mRNA 
0   NM_170116.1  CG5422-RB, transcript variant B (Rox8), mRNA 
0   NM_170117.1  CG5422-RC, transcript variant C (Rox8), mRNA 
0   NM_140169.2  CG6321-RA (CG6321), mRNA 
0   NM_057391.3  CG1977-RA (alpha-Spec), mRNA 
0   NM_078678.2  CG6500-RB, transcript variant B (Bx), mRNA 
0   NM_057455.2  CG3827-RA (sc), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.