National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 6097R-3 
 Symbol rt  Full Name rotated abdomen 
 CG No CG6097  Old CG No CG6097 
 Synonyms Rot_abd, dPOMT1, pomt, DPOMT1, fs(3)neo1, CG6097, rt, POMT1 
 Accession No (Link to NCBI)  
 Inserted Chr. ll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees late pupal lethal 
 Map Viewer
 Reference
[Please submit your publication]
Yamamoto-Hino M, Yoshida H, Ichimiya T, Sakamura S, Maeda M, Kimura Y, Sasaki N, Aoki-Kinoshita KF, Kinoshita-Toyoda A, Toyoda H, Ueda R, Nishihara S, Goto S.
Phenotype-based clustering of glycosylation-related genes by RNAi-mediated gene silencing.
Genes Cells (2015) 20(6) 521-42 [ PubMed ID = 25940448 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgCAACACCAATGGACAGGCAGC 
 Primer Seq. 3'
aatctagaggtaccAAACGCGTGCCGAAGGCCAAG 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 CAACACCAAT GGACAGGCAG CGATTTGAGC GGCGAGTCAA ACGAAAGACT TCACTTTCGC 
0061 AGCCGTTCAA CAAACTCGAT GCAACAACAC ACAGCAATCA GCAACTCACC TTCACCACTG 
0121 TGCTGTAACG GCGCTCGTGC TTTAACAATG CTCAATTGCT GCGTCGACGT CAACTGTCAT 
0181 TTGAATGCGC CGCTCCGCGG CAGCGTTAAC CGGCACACGA CGCCAACGCC GACCCCGACT 
0241 GCGACGCCAA CGCCGGTAGC GACGCCAAAA CAAGCCTCCC CCTCGCCTAC CTCCGATCGT 
0301 TCGCGCTCCC TCTCACGCTC GCCTTCGCCG TCTCGGTCTC GCTCGCTCTC CTGCCAAAAA 
0361 CAAATCGACA AGAACAGCGC TGGCGCAG-A TCCGCAGAAG AGAGAAAAAC CGCTAATGCG 
0421 AGTTCGCAGC CATTTACCGT TAACCTGAGA ATCGATCTCT TCAGTTGGAC ACTCTTTCTC 
0481 TTGGCCTTCG GCACGCGTTT  
 in silico PCR Fragment
0001 caacaccaat ggacaggcag cgatttgagc ggcgagtcaa acgaaagact tcactttcgc 
0061 agccgttcaa caaactcgat gcaacaacac acagcaatca gcaactcacc ttcaccactg 
0121 tgctgtaacg gcgctcgtgc tttaacaatg ctcaattgct gcgtcgacgt caactgtcat 
0181 ttgaatgcgc cgctccgcgg cagcgttaac cggcacacga cgccaacgcc gaccccgact 
0241 gcgacgccaa cgccggtagc gacgccaaaa caagcctccc cctcgcctac ctccgatcgt 
0301 tcgcgctccc tctcacgctc gccttcgccg tctcggtctc gctcgctctc ctgccaaaaa 
0361 caaatcgaca agaacagcgc tggcgcagca tccgcagaag agagaaaaac cgctaatgcg 
0421 agttcgcagc catttaccgt taacctgaga atcgatctct tcagttggac actctttctc 
0481 ttggccttcg gcacgcgttt  
 Assemble Data

6097R-3.IR full       1   CAACACCAATGGACAGGCAGCGATTTGAGCGGCGAGTCAAACGAAAGACTTCACTTTCGC 60
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
6097R-3.in silico     1   CAACACCAATGGACAGGCAGCGATTTGAGCGGCGAGTCAAACGAAAGACTTCACTTTCGC 60


6097R-3.IR full       61  AGCCGTTCAACAAACTCGATGCAACAACACACAGCAATCAGCAACTCACCTTCACCACTG 120
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
6097R-3.in silico     61  AGCCGTTCAACAAACTCGATGCAACAACACACAGCAATCAGCAACTCACCTTCACCACTG 120


6097R-3.IR full       121 TGCTGTAACGGCGCTCGTGCTTTAACAATGCTCAATTGCTGCGTCGACGTCAACTGTCAT 180
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
6097R-3.in silico     121 TGCTGTAACGGCGCTCGTGCTTTAACAATGCTCAATTGCTGCGTCGACGTCAACTGTCAT 180


6097R-3.IR full       181 TTGAATGCGCCGCTCCGCGGCAGCGTTAACCGGCACACGACGCCAACGCCGACCCCGACT 240
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
6097R-3.in silico     181 TTGAATGCGCCGCTCCGCGGCAGCGTTAACCGGCACACGACGCCAACGCCGACCCCGACT 240


6097R-3.IR full       241 GCGACGCCAACGCCGGTAGCGACGCCAAAACAAGCCTCCCCCTCGCCTACCTCCGATCGT 300
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
6097R-3.in silico     241 GCGACGCCAACGCCGGTAGCGACGCCAAAACAAGCCTCCCCCTCGCCTACCTCCGATCGT 300


6097R-3.IR full       301 TCGCGCTCCCTCTCACGCTCGCCTTCGCCGTCTCGGTCTCGCTCGCTCTCCTGCCAAAAA 360
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
6097R-3.in silico     301 TCGCGCTCCCTCTCACGCTCGCCTTCGCCGTCTCGGTCTCGCTCGCTCTCCTGCCAAAAA 360


6097R-3.IR full       361 CAAATCGACAAGAACAGCGCTGGCGCAG-ATCCGCAGAAGAGAGAAAAACCGCTAATGCG 420
                          |||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||
6097R-3.in silico     361 CAAATCGACAAGAACAGCGCTGGCGCAGCATCCGCAGAAGAGAGAAAAACCGCTAATGCG 420


6097R-3.IR full       421 AGTTCGCAGCCATTTACCGTTAACCTGAGAATCGATCTCTTCAGTTGGACACTCTTTCTC 480
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
6097R-3.in silico     421 AGTTCGCAGCCATTTACCGTTAACCTGAGAATCGATCTCTTCAGTTGGACACTCTTTCTC 480


6097R-3.IR full       481 TTGGCCTTCGGCACGCGTTT 500
                          ||||||||||||||||||||
6097R-3.in silico     481 TTGGCCTTCGGCACGCGTTT 500

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100  482  NM_079301.2  rotated abdomen CG6097-RA (rt), mRNA 
NM_130624.2  CG16903-RA (CG16903), mRNA 
NM_132792.2  CG6227-RA (CG6227), mRNA 
NM_058149.3  fat CG3352-RA (ft), mRNA 
NM_057664.4  inebriated CG15444-RB, transcript variant B (ine), mRNA 
NM_175959.1  inebriated CG15444-RD, transcript variant D (ine), mRNA 
NM_175958.1  inebriated CG15444-RC, transcript variant C (ine), mRNA 
NM_132163.2  Downstream of kinase CG2079-RA (Dok), mRNA 
NM_057804.2  APC-like CG1451-RA (Apc), mRNA 
NM_169302.1  unc-115 CG31332-RA, transcript variant A (unc-115), mRNA 
NM_169303.2  unc-115 CG31332-RB, transcript variant B (unc-115), mRNA 
NM_169300.2  unc-115 CG31332-RD, transcript variant D (unc-115), mRNA 
NM_169301.2  unc-115 CG31332-RC, transcript variant C (unc-115), mRNA 
NM_141673.4  CG31352-RA (CG31352), mRNA 
NM_001038777.1  CG33992-RA (CG33992), mRNA 
NM_135239.1  CG18304-RA (CG18304), mRNA 
NM_165627.1  CG8740-RC, transcript variant C (CG8740), mRNA 
NM_164904.1  CG18619-RD, transcript variant D (CG18619), mRNA 
NM_135519.1  CG18619-RA, transcript variant A (CG18619), mRNA 
NM_164905.1  CG18619-RC, transcript variant C (CG18619), mRNA 
NM_164903.1  CG18619-RB, transcript variant B (CG18619), mRNA 
NM_165626.1  CG8740-RB, transcript variant B (CG8740), mRNA 
NM_136567.2  CG8740-RA, transcript variant A (CG8740), mRNA 
NM_137611.1  CG16894-RA (CG16894), mRNA 
NM_136940.1  CG8830-RA, transcript variant A (CG8830), mRNA 
NM_165900.1  CG8830-RB, transcript variant B (CG8830), mRNA 
NM_168239.1  PAR-domain protein 1 CG17888-RC, transcript variant C (Pdp1), mRNA 
NM_168238.1  PAR-domain protein 1 CG17888-RH, transcript variant H (Pdp1), mRNA 
NM_168237.1  PAR-domain protein 1 CG17888-RD, transcript variant D (Pdp1), mRNA 
NM_080093.2  PAR-domain protein 1 CG17888-RE, transcript variant E (Pdp1), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.