National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock discarded request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 6084R-3 
 Symbol CG6084  Full Name CG6084 
 CG No CG6084  Old CG No CG6084 
 Synonyms CG6084, 34F4T, ESTS:34F4T 
 Accession No (Link to NCBI) NM_140227.1 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
 Reference
[Please submit your publication]
Yang S, Zhao Y, Yu J, Fan Z, Gong ST, Tang H, Pan L.
Sugar Alcohols of Polyol Pathway Serve as Alarmins to Mediate Local-Systemic Innate Immune Communication in Drosophila.
Cell Host Microbe (2019) [ PubMed ID = 31350199 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgAATCATTGGACTGGGAACCTG 
 Primer Seq. 3'
aatctagaggtaccTGGTTACTGGTGGAATAGTGG 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 AATCATTGGA CTGGGAACCT GGGGCAGCCC CAAgGGTCAG GTCACCGAGG CTGTCAAAGT 
0061 TGCCATTGAT GCCGGATACA GGCACATTGA CTGTGNCTAT GTATACCAAA ACGAGGATGA 
0121 GGTCGGAGAT GGTGTTGAGG CCAAGATCAA GGAGGGCGTT GTCAAGCGTG AGGATCTGTT 
0181 CATCACCAGC AAACTGTGGA ACACTTTCCA TCGCCCGGAT CTTGTCAAGT CGGCATTGGA 
0241 GAACACATTG AGCTCCCTGA AGCTGAAGTA CCTCGATCTG TACCTTATCC ACTGGNCCAT 
0301 GGGCTACAAG GAGGGATGCG ATCTGTTCCC CACCGACAAG GATGGCAAGA CGCTGTACTC 
0361 GCCGGTTGAT TACGTCGACA CGTGGAAGGC CATGGAGAAG TTGGTGGAAG AGGGTCTGGT 
0421 CAAGTCCATT GGTGTTTCCA ACTTCAACAG AAGGCAGATC GAGCGCGTGC TTGAGGTGGC 
0481 CACTATTCCA CCAGTAACCA  
 in silico PCR Fragment
0001 AATCATTGGA CTGGGAACCT GGGGCAGCCC CAAGGGTCAG GTCACCGAGG CTGTCAAAGT 
0061 TGCCATTGAT GCCGGATACA GGCACATTGA CTGTGCCTAT GTATACCAAA ACGAGGATGA 
0121 GGTCGGAGAT GGTGTTGAGG CCAAGATCAA GGAGGGCGTT GTCAAGCGTG AGGATCTGTT 
0181 CATCACCAGC AAACTGTGGA ACACTTTCCA TCGCCCGGAT CTTGTCAAGT CGGCATTGGA 
0241 GAACACATTG AGCTCCCTGA AGCTGAAGTA CCTCGATCTG TACCTTATCC ACTGGCCCAT 
0301 GGGCTACAAG GAGGGATGCG ATCTGTTCCC CACCGACAAG GATGGCAAGA CGCTGTACTC 
0361 GCCGGTTGAT TACGTCGACA CGTGGAAGGC CATGGAGAAG TTGGTGGAAG AGGGTCTGGT 
0421 CAAGTCCATT GGTGTTTCCA ACTTCAACAG AAGGCAGATC GAGCGCGTGC TTGAGGTGGC 
0481 CACTATTCCA CCAGTAACCA  
 Assemble Data

6084R-3.IR_full       1   AATCATTGGACTGGGAACCTGGGGCAGCCCCAAGGGTCAGGTCACCGAGGCTGTCAAAGT 60
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
6084R-3.in silico     1   AATCATTGGACTGGGAACCTGGGGCAGCCCCAAGGGTCAGGTCACCGAGGCTGTCAAAGT 60


6084R-3.IR_full       61  TGCCATTGATGCCGGATACAGGCACATTGACTGTGNCTATGTATACCAAAACGAGGATGA 120
                          ||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||
6084R-3.in silico     61  TGCCATTGATGCCGGATACAGGCACATTGACTGTGCCTATGTATACCAAAACGAGGATGA 120


6084R-3.IR_full       121 GGTCGGAGATGGTGTTGAGGCCAAGATCAAGGAGGGCGTTGTCAAGCGTGAGGATCTGTT 180
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
6084R-3.in silico     121 GGTCGGAGATGGTGTTGAGGCCAAGATCAAGGAGGGCGTTGTCAAGCGTGAGGATCTGTT 180


6084R-3.IR_full       181 CATCACCAGCAAACTGTGGAACACTTTCCATCGCCCGGATCTTGTCAAGTCGGCATTGGA 240
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
6084R-3.in silico     181 CATCACCAGCAAACTGTGGAACACTTTCCATCGCCCGGATCTTGTCAAGTCGGCATTGGA 240


6084R-3.IR_full       241 GAACACATTGAGCTCCCTGAAGCTGAAGTACCTCGATCTGTACCTTATCCACTGGNCCAT 300
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||
6084R-3.in silico     241 GAACACATTGAGCTCCCTGAAGCTGAAGTACCTCGATCTGTACCTTATCCACTGGCCCAT 300


6084R-3.IR_full       301 GGGCTACAAGGAGGGATGCGATCTGTTCCCCACCGACAAGGATGGCAAGACGCTGTACTC 360
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
6084R-3.in silico     301 GGGCTACAAGGAGGGATGCGATCTGTTCCCCACCGACAAGGATGGCAAGACGCTGTACTC 360


6084R-3.IR_full       361 GCCGGTTGATTACGTCGACACGTGGAAGGCCATGGAGAAGTTGGTGGAAGAGGGTCTGGT 420
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
6084R-3.in silico     361 GCCGGTTGATTACGTCGACACGTGGAAGGCCATGGAGAAGTTGGTGGAAGAGGGTCTGGT 420


6084R-3.IR_full       421 CAAGTCCATTGGTGTTTCCAACTTCAACAGAAGGCAGATCGAGCGCGTGCTTGAGGTGGC 480
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
6084R-3.in silico     421 CAAGTCCATTGGTGTTTCCAACTTCAACAGAAGGCAGATCGAGCGCGTGCTTGAGGTGGC 480


6084R-3.IR_full       481 CACTATTCCACCAGTAACCA 500
                          ||||||||||||||||||||
6084R-3.in silico     481 CACTATTCCACCAGTAACCA 500

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_140227.1  CG6084-RA, transcript variant A (CG6084), mRNA 
94.81   457  NM_168467.1  CG6084-RB, transcript variant B (CG6084), mRNA 
0.2   NM_169685.1  CG8884-RC, transcript variant C (Sap47), mRNA 
0.2   NM_169690.1  CG8884-RB, transcript variant B (Sap47), mRNA 
0.2   NM_079647.2  CG8884-RF, transcript variant F (Sap47), mRNA 
0.2   NM_169689.1  CG8884-RG, transcript variant G (Sap47), mRNA 
0.2   NM_169687.1  CG8884-RE, transcript variant E (Sap47), mRNA 
0.2   NM_169686.1  CG8884-RD, transcript variant D (Sap47), mRNA 
0.2   NM_169684.1  CG8884-RA, transcript variant A (Sap47), mRNA 
0.2   NM_169688.1  CG8884-RH, transcript variant H (Sap47), mRNA 
0   18  33  NM_140228.1  CG6083-RA (CG6083), mRNA 
0   NM_170215.1  CG31288-RA (CG31288), mRNA 
0   NM_167266.1  CG12101-RB, transcript variant B (Hsp60), mRNA 
0   NM_078560.2  CG12101-RA, transcript variant A (Hsp60), mRNA 
0   NM_143747.2  CG3762-RA, transcript variant A (Vha68-2), mRNA 
0   NM_165021.1  CG3762-RB, transcript variant B (Vha68-2), mRNA 
0   NM_165022.1  CG3762-RC, transcript variant C (Vha68-2), mRNA 
0   NM_138154.2  CG32475-RA (mthl8), mRNA 
0   NM_165180.1  CG11397-RA (glu), mRNA 
0   14  NM_139582.1  CG12766-RA (CG12766), mRNA 
0   NM_168199.1  CG8606-RB, transcript variant B (RhoGEF4), mRNA 
0   NM_139844.2  CG8606-RA, transcript variant A (RhoGEF4), mRNA 
0   NM_001014592.1  CG12306-RB, transcript variant B (polo), mRNA 
0   NM_079455.3  CG12306-RA, transcript variant A (polo), mRNA 
0   NM_133108.2  CG32542-RA (CG32542), mRNA 
0   NM_135741.2  CG5776-RA (CG5776), mRNA 
0   NM_079739.2  CG10161-RB (eIF-3p66), mRNA 
0   NM_169434.1  CG6946-RB, transcript variant B (glo), mRNA 
0   NM_141863.1  CG6946-RA, transcript variant A (glo), mRNA 
0   NM_169435.1  CG6946-RC, transcript variant C (glo), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.