National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 6084R-1 
 Symbol CG6084  Full Name CG6084 
 CG No CG6084  Old CG No CG6084 
 Synonyms CG6084, 34F4T, ESTS:34F4T 
 Accession No (Link to NCBI) NM_140227.1 
 Inserted Chr. ll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
[Please submit your publication]
Yang S, Zhao Y, Yu J, Fan Z, Gong ST, Tang H, Pan L.
Sugar Alcohols of Polyol Pathway Serve as Alarmins to Mediate Local-Systemic Innate Immune Communication in Drosophila.
Cell Host Microbe (2019) [ PubMed ID = 31350199 ] [ RRC reference ]  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
 Primer Seq. 3'
 Predicted Fragment Size
 IR fragment full Seq
 in silico PCR Fragment
 Assemble Data

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     1   AATCATTGGACTGGGAACCTGGGGCAGCCCCAAGGGTCAGGTCACCGAGGCTGTCAAAGT 60

                          ||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| silico     61  TGCCATTGATGCCGGATACAGGCACATTGACTGTGCCTATGTATACCAAAACGAGGATGA 120

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     121 GGTCGGAGATGGTGTTGAGGCCAAGATCAAGGAGGGCGTTGTCAAGCGTGAGGATCTGTT 180

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     181 CATCACCAGCAAACTGTGGAACACTTTCCATCGCCCGGATCTTGTCAAGTCGGCATTGGA 240

                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| silico     241 GAACACATTGAGCTCCCTGAAGCTGAAGTACCTCGATCTGTACCTTATCCACTGGCCCAT 300

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     301 GGGCTACAAGGAGGGATGCGATCTGTTCCCCACCGACAAGGATGGCAAGACGCTGTACTC 360

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     361 GCCGGTTGATTACGTCGACACGTGGAAGGCCATGGAGAAGTTGGTGGAAGAGGGTCTGGT 420

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     421 CAAGTCCATTGGTGTTTCCAACTTCAACAGAAGGCAGATCGAGCGCGTGCTTGAGGTGGC 480

6084R-1.IR_full       481 CACTATTCCACCAGTAACCA 500
                          |||||||||||||||||||| silico     481 CACTATTCCACCAGTAACCA 500

 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_140227.1  CG6084-RA, transcript variant A (CG6084), mRNA 
94.81   457  NM_168467.1  CG6084-RB, transcript variant B (CG6084), mRNA 
0.2   NM_169685.1  CG8884-RC, transcript variant C (Sap47), mRNA 
0.2   NM_169690.1  CG8884-RB, transcript variant B (Sap47), mRNA 
0.2   NM_079647.2  CG8884-RF, transcript variant F (Sap47), mRNA 
0.2   NM_169689.1  CG8884-RG, transcript variant G (Sap47), mRNA 
0.2   NM_169687.1  CG8884-RE, transcript variant E (Sap47), mRNA 
0.2   NM_169686.1  CG8884-RD, transcript variant D (Sap47), mRNA 
0.2   NM_169684.1  CG8884-RA, transcript variant A (Sap47), mRNA 
0.2   NM_169688.1  CG8884-RH, transcript variant H (Sap47), mRNA 
0   18  33  NM_140228.1  CG6083-RA (CG6083), mRNA 
0   NM_170215.1  CG31288-RA (CG31288), mRNA 
0   NM_167266.1  CG12101-RB, transcript variant B (Hsp60), mRNA 
0   NM_078560.2  CG12101-RA, transcript variant A (Hsp60), mRNA 
0   NM_143747.2  CG3762-RA, transcript variant A (Vha68-2), mRNA 
0   NM_165021.1  CG3762-RB, transcript variant B (Vha68-2), mRNA 
0   NM_165022.1  CG3762-RC, transcript variant C (Vha68-2), mRNA 
0   NM_138154.2  CG32475-RA (mthl8), mRNA 
0   NM_165180.1  CG11397-RA (glu), mRNA 
0   14  NM_139582.1  CG12766-RA (CG12766), mRNA 
0   NM_168199.1  CG8606-RB, transcript variant B (RhoGEF4), mRNA 
0   NM_139844.2  CG8606-RA, transcript variant A (RhoGEF4), mRNA 
0   NM_001014592.1  CG12306-RB, transcript variant B (polo), mRNA 
0   NM_079455.3  CG12306-RA, transcript variant A (polo), mRNA 
0   NM_133108.2  CG32542-RA (CG32542), mRNA 
0   NM_135741.2  CG5776-RA (CG5776), mRNA 
0   NM_079739.2  CG10161-RB (eIF-3p66), mRNA 
0   NM_169434.1  CG6946-RB, transcript variant B (glo), mRNA 
0   NM_141863.1  CG6946-RA, transcript variant A (glo), mRNA 
0   NM_169435.1  CG6946-RC, transcript variant C (glo), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.