National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock discarded request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 6083R-2 
 Symbol CG6083  Full Name CG6083 
 CG No CG6083  Old CG No CG6083 
 Synonyms CG6083 
 Accession No (Link to NCBI) NM_140228.1 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees viable 
 Map Viewer
 Reference
[Please submit your publication]
Kobayashi M, Michaut L, Ino A, Honjo K, Nakajima T, Maruyama Y, Mochizuki H, Ando M, Ghangrekar I, Takahashi K, Saigo K, Ueda R, Gehring WJ, Furukubo-Tokunaga K.
Differential microarray analysis of Drosophila mushroom body transcripts using chemical ablation.
Proc. Natl. Acad. Sci. U.S.A. (2006) 103(39) 14417-22 [ PubMed ID = 16971484 ] [ RRC reference ]

Kamimura K, Koyama T, Habuchi H, Ueda R, Masu M, Kimata K, Nakato H.
Specific and flexible roles of heparan sulfate modifications in Drosophila FGF signaling.
J. Cell Biol. (2006) 174(6) 773-8 [ PubMed ID = 16966419 ] [ RRC reference ]

Umemori M, Habara O, Iwata T, Maeda K, Nishinoue K, Okabe A, Takemura M, Takahashi K, Saigo K, Ueda R, Adachi-Yamada T.
RNAi-mediated knockdown showing impaired cell survival in Drosophila wing imaginal disc.
Gene Regul Syst Bio (2009) 3 11-20 [ PubMed ID = 19838331 ] [ RRC reference ]

Tiwari P, Kumar A, Das RN, Malhotra V, VijayRaghavan K.
A Tendon Cell Specific RNAi Screen Reveals Novel Candidates Essential for Muscle Tendon Interaction.
PLoS ONE (2015) 10(10) e0140976 [ PubMed ID = 26488612 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgCCTATGTTGGGTCTCGGAACT 
 Primer Seq. 3'
aatctagaggtaccGGTTTAAGCTTGGCCACACTG 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 CCTATGTTGG GTCTCGGAAC TTGGCGGAGC CCGCCGGAAG TGGTGACCCA AGCAGTAAAG 
0061 GATGCCATTG ATATAGGCTA TCGCCATTTT GACTGCGCTC ATATCTATGG CAATGAGGCG 
0121 CAAGTGGGAG CTGCTCTCCG GGAGAAAATG GACGAGGGAG TGGTCACACG AGATGAACTC 
0181 TTCATCACGA GCAAACTTTG GAACACACAC CACAAGCCGG ATTTGGTGCG CCCGGCATGT 
0241 GAGACAAGCA TAAGGAACTT GGGAGTCAAG TACCTAAACC TCTACCTGAT GCANCTGGCC 
0301 CATGGCCTAC AAGTCGGGCA GTGACAACCT ATATCCCACG TGTCCGGACA CCAATAAGGC 
0361 CGCATTCGAG GACATCGACT ATGTGGACAC GTGGCGTGCA ATGGAGAATC TGGTGGACGA 
0421 GGGTCTGTNC CAGGCCATCG GTGTGTCTAA CTTCAATGAG CAGCAGATGA ATAGACTTCT 
0481 CAGTGTgGCC AAGCTTAAAC C 
 in silico PCR Fragment
0001 CCTATGTTGG GTCTCGGAAC TTGGCGGAGC CCGCCGGAAG TGGTGACCCA AGCAGTAAAG 
0061 GATGCTATTG ATATAGGCTA TCGCCATTTT GACTGCGCTC ATATCTATGG CAATGAGGCG 
0121 CAAGTGGGAG CTGCTCTCCG GGAGAAAATG GACGAGGGAG TGGTCACACG AGATGAACTC 
0181 TTCATCACGA GCAAACTTTG GAACACACAC CACAAGCCGG ATTTGGTGCG CCCGGCATGT 
0241 GAGACAAGCA TAAGGAACTT GGGAGTCAAG TACCTAAACC TCTACCTGAT GCA-CTGGCC 
0301 CATGGCCTAC AAGTCGGGCA GTGACAACCT ATATCCCACG TGTCCGGACA CCAATAAGGC 
0361 CGCATTCGAG GACATCGACT ATGTGGACAC GTGGCGTGCA ATGGAGAATC TGGTGGACGA 
0421 GGGTCTGTGC CAGGCCATCG GTGTGTCTAA CTTCAATGAG CAGCAGATGA ATAGACTTCT 
0481 CAGTGTGGCC AAGCTTAAAC C 
 Assemble Data

6083R-2.IR_full       1   CCTATGTTGGGTCTCGGAACTTGGCGGAGCCCGCCGGAAGTGGTGACCCAAGCAGTAAAG 60
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
6083R-2.in silico     1   CCTATGTTGGGTCTCGGAACTTGGCGGAGCCCGCCGGAAGTGGTGACCCAAGCAGTAAAG 60


6083R-2.IR_full       61  GATGCCATTGATATAGGCTATCGCCATTTTGACTGCGCTCATATCTATGGCAATGAGGCG 120
                          ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||
6083R-2.in silico     61  GATGCTATTGATATAGGCTATCGCCATTTTGACTGCGCTCATATCTATGGCAATGAGGCG 120


6083R-2.IR_full       121 CAAGTGGGAGCTGCTCTCCGGGAGAAAATGGACGAGGGAGTGGTCACACGAGATGAACTC 180
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
6083R-2.in silico     121 CAAGTGGGAGCTGCTCTCCGGGAGAAAATGGACGAGGGAGTGGTCACACGAGATGAACTC 180


6083R-2.IR_full       181 TTCATCACGAGCAAACTTTGGAACACACACCACAAGCCGGATTTGGTGCGCCCGGCATGT 240
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
6083R-2.in silico     181 TTCATCACGAGCAAACTTTGGAACACACACCACAAGCCGGATTTGGTGCGCCCGGCATGT 240


6083R-2.IR_full       241 GAGACAAGCATAAGGAACTTGGGAGTCAAGTACCTAAACCTCTACCTGATGCANCTGGCC 300
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||
6083R-2.in silico     241 GAGACAAGCATAAGGAACTTGGGAGTCAAGTACCTAAACCTCTACCTGATGCA-CTGGCC 300


6083R-2.IR_full       301 CATGGCCTACAAGTCGGGCAGTGACAACCTATATCCCACGTGTCCGGACACCAATAAGGC 360
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
6083R-2.in silico     301 CATGGCCTACAAGTCGGGCAGTGACAACCTATATCCCACGTGTCCGGACACCAATAAGGC 360


6083R-2.IR_full       361 CGCATTCGAGGACATCGACTATGTGGACACGTGGCGTGCAATGGAGAATCTGGTGGACGA 420
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
6083R-2.in silico     361 CGCATTCGAGGACATCGACTATGTGGACACGTGGCGTGCAATGGAGAATCTGGTGGACGA 420


6083R-2.IR_full       421 GGGTCTGTNCCAGGCCATCGGTGTGTCTAACTTCAATGAGCAGCAGATGAATAGACTTCT 480
                          |||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||
6083R-2.in silico     421 GGGTCTGTGCCAGGCCATCGGTGTGTCTAACTTCAATGAGCAGCAGATGAATAGACTTCT 480


6083R-2.IR_full       481 CAGTGTGGCCAAGCTTAAACC 501
                          |||||||||||||||||||||
6083R-2.in silico     481 CAGTGTGGCCAAGCTTAAACC 501

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_140228.1  CG6083-RA (CG6083), mRNA 
0.62   14  NM_139583.2  CG10863-RA (CG10863), mRNA 
0   17  24  NM_136391.2  CG9436-RA (CG9436), mRNA 
0   NM_135116.2  CG7239-RA (CG7239), mRNA 
0   18  33  NM_168467.1  CG6084-RB, transcript variant B (CG6084), mRNA 
0   18  33  NM_140227.1  CG6084-RA, transcript variant A (CG6084), mRNA 
0   NM_143955.1  CG14359-RA (CG14359), mRNA 
0   NM_134714.3  CG4341-RA (CG4341), mRNA 
0   NM_143084.1  CG11847-RA (CG11847), mRNA 
0   NM_140955.2  CG5649-RA (kin17), mRNA 
0   NM_057685.3  CG11527-RA (Tig), mRNA 
0   NM_135564.3  CG6206-RA, transcript variant A (CG6206), mRNA 
0   NM_142019.2  CG32473-RB, transcript variant B (CG32473), mRNA 
0   NM_169504.1  CG32473-RC, transcript variant C (CG32473), mRNA 
0   NM_164929.1  CG6206-RB, transcript variant B (CG6206), mRNA 
0   NM_169503.1  CG32473-RA, transcript variant A (CG32473), mRNA 
0   NM_135486.3  CG13126-RA (CG13126), mRNA 
0   NM_078573.2  CG1822-RC, transcript variant C (bif), mRNA 
0   NM_167295.1  CG1822-RB, transcript variant B (bif), mRNA 
0   NM_140475.1  CG10006-RA (CG10006), mRNA 
0   NM_141996.2  CG12360-RA, transcript variant A (CG12360), mRNA 
0   NM_169493.1  CG12360-RB, transcript variant B (CG12360), mRNA 
0   NM_169384.2  CG31386-RA (CG31386), mRNA 
0   10  NM_135104.4  CG7235-RC, transcript variant C (Hsp60C), mRNA 
0   10  NM_164655.2  CG7235-RB, transcript variant B (Hsp60C), mRNA 
0   10  NM_164654.1  CG7235-RA, transcript variant A (Hsp60C), mRNA 
0   NM_139582.1  CG12766-RA (CG12766), mRNA 
0   NM_078670.2  CG7092-RA (Dhc16F), mRNA 
0   NM_079814.2  CG5502-RA (RpL4), mRNA 
0   NM_001043082.1  CG11798-RC, transcript variant C (chn), mRNA 
 Wing Disc
GFP
Puc
Caspase
DAPI
Merge
Figure
JNK signal
N
 
DB
DC
++ 
DM
+- 
VM
 
VB
 
Caspase-3 signal
N
 
DB
DC
++ 
DM
VM
 
VB
 
Dcompartment   Penetrance
     

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.