National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock discarded request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 6048R-3 
 Symbol CG6048  Full Name CG6048 
 CG No CG6048  Old CG No CG6048 
 Synonyms SP108, CG6048 
 Accession No (Link to NCBI) NM_132054.1 
 Inserted Chr. lll 
 Insertional Mutation  lethal 
 Phenotype induced by Act5C-GAL4 at 28 degrees viable 
 Map Viewer
 Reference
[Please submit your publication]
Kambris Z, Brun S, Jang IH, Nam HJ, Romeo Y, Takahashi K, Lee WJ, Ueda R, Lemaitre B.
Drosophila immunity: a large-scale in vivo RNAi screen identifies five serine proteases required for Toll activation.
Curr Biol (2006) 16(8) 808-13 [ PubMed ID = 16631589 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgCACTTGGACACGAAGGCCATC 
 Primer Seq. 3'
aatctagaggtaccTAGCCATCCTCCGTATTGCCC 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 CACTTGGACA CGAAGGCCAT CCGTCCGAGA TTCAATGCGG ATCCCGGCAG GATTATCAAT 
0061 GGAACAGAGG CCTCTCTGGG CGCAACCAGG CATCAGGTGG GCATTCGCAA GGCTCTCAAC 
0121 GATGGCTACT TCTTTGGAAC CGGGCACCTT TGCGGAGGAT CTCTCATCCG GCCGGGATGG 
0181 GTACTCACCG CCGCCCATTG CTTTGTGGAT CAGATTATTT ACGACGGCAC TTTCGTGCCC 
0241 AAGGAGGAGT TCATCGTGGT GATGGGTAAC CTGGATCGCT ACAATCGCAC CAACACGCTA 
0301 ACATTCACGA TCGAAGAGCG CATAATGCAG CTGGATAAGT TCGACCTTTC CACCTACGAC 
0361 AAGGACATCG CCCTGCTGAT GCTGAATGGT ACTGTACCCA CTGGACATCC GACCATTCGT 
0421 CCAATTGCCC TCAATCGGTT TGCCATACCG GAGGGCGTCG TCTGCCAGGT GACGGGCTGG 
0481 GGCAATACGG AGGATGGCTA  
 in silico PCR Fragment
0001 CACTTGGACA CGAAGGCCAT CCGTCCGAGA TTCAATGCGG ATCCCGGCAG GATTATCAAT 
0061 GGAACAGAGG CCTCTCTGGG CGCAACTAGG CATCAGGTGG GCATTCGCAA GGCTCTCAAC 
0121 GATGGCTACT TCTTTGGAAC CGGGCACCTT TGCGGAGGAT CTCTCATCCG GCCGGGATGG 
0181 GTACTCACCG CCGCCCATTG CTTTGTGGAT CAGATTATTT ACGACGGCAC TTTCGTGCCC 
0241 AAGGAGGAGT TCATCGTGGT GATGGGTAAC CTGGATCGCT ACAATCGCAC CAACACGCTA 
0301 ACATTCACGA TCGAAGAGCG CATAATGCAG CTGGATAAGT TCGACCTTTC CACCTACGAC 
0361 AAGGACATCG CCCTGCTGAT GCTGAATGGT ACTGTACCCA CTGGACATCC GACCATTCGT 
0421 CCAATTGCCC TCAATCGGTT TGCCATACCG GAGGGCGTCG TCTGCCAGGT GACGGGCTGG 
0481 GGCAATACGG AGGATGGCTA  
 Assemble Data

6048R-3.IR_full       1   CACTTGGACACGAAGGCCATCCGTCCGAGATTCAATGCGGATCCCGGCAGGATTATCAAT 60
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
6048R-3.in silico     1   CACTTGGACACGAAGGCCATCCGTCCGAGATTCAATGCGGATCCCGGCAGGATTATCAAT 60


6048R-3.IR_full       61  GGAACAGAGGCCTCTCTGGGCGCAACCAGGCATCAGGTGGGCATTCGCAAGGCTCTCAAC 120
                          |||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||
6048R-3.in silico     61  GGAACAGAGGCCTCTCTGGGCGCAACTAGGCATCAGGTGGGCATTCGCAAGGCTCTCAAC 120


6048R-3.IR_full       121 GATGGCTACTTCTTTGGAACCGGGCACCTTTGCGGAGGATCTCTCATCCGGCCGGGATGG 180
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
6048R-3.in silico     121 GATGGCTACTTCTTTGGAACCGGGCACCTTTGCGGAGGATCTCTCATCCGGCCGGGATGG 180


6048R-3.IR_full       181 GTACTCACCGCCGCCCATTGCTTTGTGGATCAGATTATTTACGACGGCACTTTCGTGCCC 240
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
6048R-3.in silico     181 GTACTCACCGCCGCCCATTGCTTTGTGGATCAGATTATTTACGACGGCACTTTCGTGCCC 240


6048R-3.IR_full       241 AAGGAGGAGTTCATCGTGGTGATGGGTAACCTGGATCGCTACAATCGCACCAACACGCTA 300
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
6048R-3.in silico     241 AAGGAGGAGTTCATCGTGGTGATGGGTAACCTGGATCGCTACAATCGCACCAACACGCTA 300


6048R-3.IR_full       301 ACATTCACGATCGAAGAGCGCATAATGCAGCTGGATAAGTTCGACCTTTCCACCTACGAC 360
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
6048R-3.in silico     301 ACATTCACGATCGAAGAGCGCATAATGCAGCTGGATAAGTTCGACCTTTCCACCTACGAC 360


6048R-3.IR_full       361 AAGGACATCGCCCTGCTGATGCTGAATGGTACTGTACCCACTGGACATCCGACCATTCGT 420
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
6048R-3.in silico     361 AAGGACATCGCCCTGCTGATGCTGAATGGTACTGTACCCACTGGACATCCGACCATTCGT 420


6048R-3.IR_full       421 CCAATTGCCCTCAATCGGTTTGCCATACCGGAGGGCGTCGTCTGCCAGGTGACGGGCTGG 480
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
6048R-3.in silico     421 CCAATTGCCCTCAATCGGTTTGCCATACCGGAGGGCGTCGTCTGCCAGGTGACGGGCTGG 480


6048R-3.IR_full       481 GGCAATACGGAGGATGGCTA 500
                          ||||||||||||||||||||
6048R-3.in silico     481 GGCAATACGGAGGATGGCTA 500

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_132054.1  CG6048-RA (CG6048), mRNA 
0   NM_142346.1  CG5246-RA (CG5246), mRNA 
0   NM_135545.2  CG5366-RA (CG5366), mRNA 
0   NM_132793.2  CG9164-RA, transcript variant A (CG9164), mRNA 
0   NM_167440.1  CG9164-RC, transcript variant C (CG9164), mRNA 
0   NM_167439.1  CG9164-RB, transcript variant B (CG9164), mRNA 
0   NM_167535.1  CG9676-RA (CG9676), mRNA 
0   NM_142910.2  CG16710-RA (CG16710), mRNA 
0   NM_001014534.1  CG15109-RD, transcript variant D (CG15109), mRNA 
0   NM_166321.1  CG15109-RB, transcript variant B (CG15109), mRNA 
0   NM_137550.2  CG15109-RA, transcript variant A (CG15109), mRNA 
0   NM_166320.1  CG15109-RC, transcript variant C (CG15109), mRNA 
0   NM_134488.2  CG14211-RB (CG14211), mRNA 
0   NM_169780.2  CG31247-RB, transcript variant B (tinc), mRNA 
0   NM_176510.1  CG31247-RD, transcript variant D (tinc), mRNA 
0   NM_176509.1  CG31247-RA, transcript variant A (tinc), mRNA 
0   NM_165694.1  CG18345-RB, transcript variant B (trpl), mRNA 
0   NM_165695.1  CG18345-RC, transcript variant C (trpl), mRNA 
0   NM_057547.3  CG18345-RA, transcript variant A (trpl), mRNA 
0   NM_134831.1  CG3609-RA (CG3609), mRNA 
0   NM_132009.2  CG11473-RA (CG11473), mRNA 
0   NM_139701.1  CG4769-RA (CG4769), mRNA 
0   NM_134694.2  CG13689-RA (CG13689), mRNA 
0   NM_140394.1  CG10133-RA (CG10133), mRNA 
0   NM_170275.1  CG5462-RA, transcript variant A (scrib), mRNA 
0   NM_001043296.1  CG5462-RG, transcript variant G (scrib), mRNA 
0   NM_170276.1  CG5462-RB, transcript variant B (scrib), mRNA 
0   NM_080015.2  CG5462-RD, transcript variant D (scrib), mRNA 
0   NM_001014670.2  CG5462-RH, transcript variant H (scrib), mRNA 
0   NM_206195.1  CG33226-RA (CG33226), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.