National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock discarded request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 6033R-2 
 Symbol drk  Full Name downstream of receptor kinase 
 CG No CG6033  Old CG No CG6033 
 Synonyms drk, Drk, Drk/Grb2, DRK, CG6033, Grb2/drk, Su(sev)R1, crkl, E(sev)2B, l(2)k13809, P1112, l(2)10626, 24/1, GRB2, Grb/drk 
 Accession No (Link to NCBI)  
 Inserted Chr. ll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees early pupal lethal 
 Map Viewer
[Please submit your publication]
Lu TY, Doherty J, Freeman MR.
DRK/DOS/SOS converge with Crk/Mbc/dCed-12 to activate Rac1 during glial engulfment of axonal debris.
Proc. Natl. Acad. Sci. U.S.A. (2014) 111(34) 12544-9 [ PubMed ID = 25099352 ] [ RRC reference ]  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
 Primer Seq. 3'
 Predicted Fragment Size
 IR fragment full Seq
 in silico PCR Fragment
 Assemble Data

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     1   GGCTGACGACGAGCTGAGTTTTCGCAAAACTCAGATTCTAAAGATATTAAATATGGAAGA 60

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     61  CGATTCAAATTGGTATCGCGCGGAGCTGGATGGAAAGGAAGGCCTCATACCTAGTAATTA 120

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     121 CATAGAAATGAAGAATCACGACTGGTATTACGGACGCATCACACGCGCCGATGCTGAGAA 180

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     181 GCTGCTGTCAAATAAGCACGAAGGCGCCTTCTTGATACGCATCAGCGAATCCAGTCCCGG 240

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     241 CGATTTCTCCTTATCAGTCAAATGCCCCGATGGCGTTCAGCATTTCAAGGTTCTGCGCGA 300

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     301 TGCCCAAAGCAAATTCTTCCTCTGGGTGGTCAAGTTCAACTCCCTCAACGAACTGGTCGA 360

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     361 ATATCATCGGACGGCGAGCGTGTCCCGGTCGCAGGATGTCAAATTGCGTGATATGATACC 420

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     421 TGAAGAGATGCTCGTGCAGGCGCTGTACGATTTTGTGCCACAGGAATCCGGGGAATTGGA 480

6033R-2.IR full       481 CTTCAGACGCGGCGATGTCA 500
                          |||||||||||||||||||| silico     481 CTTCAGACGCGGCGATGTCA 500

 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.