National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 5993R-1 
 Symbol os  Full Name outstretched 
 CG No CG5993  Old CG No CG5993 
 Synonyms Upd, upd, CG5993, sisC, sis-c, unp, UPD, sis-C, od, upa, sy, odsy, l(1)YM55, l(1)YC43, bdw, os, outstretched, bending-wings, outstretched-smalleye, sisterless c, small-eye, unpaired, Unpaired, Os, OS, upd1 
 Accession No (Link to NCBI) NM_080356.2 
 Inserted Chr. ll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees viable 
 Map Viewer
 Reference
[Please submit your publication]
Copf T, Goguel V, Lampin-Saint-Amaux A, Scaplehorn N, Preat T.
Cytokine signaling through the JAK/STAT pathway is required for long-term memory in Drosophila.
Proc. Natl. Acad. Sci. U.S.A. (2011) 108(19) 8059-64 [ PubMed ID = 21518857 ] [ RRC reference ]

Borensztejn A, Boissoneau E, Fernandez G, Agnès F, Pret AM.
JAK/STAT autocontrol of ligand-producing cell number through apoptosis.
Development (2013) 140(1) 195-204 [ PubMed ID = 23222440 ] [ RRC reference ]

Ohsawa S, Sato Y, Enomoto M, Nakamura M, Betsumiya A, Igaki T.
Mitochondrial defect drives non-autonomous tumour progression through Hippo signalling in Drosophila.
Nature (2012) 490(7421) 547-51 [ PubMed ID = 23023132 ] [ RRC reference ]

Álvarez-Fernández C, Tamirisa S, Prada F, Chernomoretz A, Podhajcer O, Blanco E, Martín-Blanco E.
Identification and functional analysis of healing regulators in Drosophila.
PLoS Genet. (2015) 11(2) e1004965 [ PubMed ID = 25647511 ] [ RRC reference ]

Cho Y, Lai CM, Lin KY, Hsu HJ.
A Targeted RNAi Screen Reveals Drosophila Female-Sterile Genes That Control the Size of Germline Stem Cell Niche During Development.
G3 (Bethesda) (2018) 8(7) 2345-2354 [ PubMed ID = 29764959 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgGCAACATGCAAACTTACGTGG 
 Primer Seq. 3'
aatctagaggtaccCTTTTTCTGGCTCCTCTGCTG 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 GCAAGCATGC AAACTTACGT GGCCAGCTTT GCGTATCTGA GGCGCCAGCA GATCCGCTGG 
0061 GATCAGCGGT CCATCACCCG CGAGTCCAGC ACCGCCCGCG AGCTgcGCGA GCTGCTCCTG 
0121 AGCTCGCGGC GCATCCTCTG CGAGCTGGAG ACAGCCGTCA ACCAGACGCA GAGTCCGCGC 
0181 CAGAAGCAGC GGCGCAGTGG TGCGGCGGTC ACAGCAGTTG GCGGCACCAC CATGCTGGGT 
0241 CAGCAGCTGC CACAGATCTC GCGTCTCGAG ATGAACAAGC GTTTGAAGCT GCGCTCCAAG 
0301 ACGAGTGGGC CCGGTATGGG TGGTGCTGCT TCCAGTGCAT CCATGGCGGC GGGCGAGGCG 
0361 GACTCGATCG ATATGCGCTT TGTGAAGCAC CACTACTACG ACTTTTTGCG CACCATGTAC 
0421 CAGCTGCTGC GGCGGGATGG CAAGCGGGTA AGGAGTCGGC CACGGAAGCA CCACAAGAAG 
0481 CAGCAGAGGA GCCAGAAAAA G 
 in silico PCR Fragment
0001 GCAA-CATGC AAACTTACGT GGCCAGCTTT GCGTATCTGA GGCGCCAGCA GATCCGCTGG 
0061 GATCAGCGGT CCATCACCCG CGAGTCCAGC ACCGCCCGCG AGCTGCGCGA GCTGCTCCTG 
0121 AGCTCGCGGC GCATCCTCTG CGAGCTGGAG ACAGCCGTCA ACCAGACGCA GAGTCCGCGC 
0181 CAGAAGCAGC GGCGCAGTGG TGCGGCGGTC ACAGCAGTTG GCGGCACCAC CATGCTGGGT 
0241 CAGCAGCTGC CACAGATCTC GCGTCTCGAG ATGAACAAGC GTTTGAAGCT GCGCTCCAAG 
0301 ACGAGTGGGC CCGGTATGGG TGGTGCTGCT TCCAGTGCAT CCATGGCGGC GGGCGAGGCG 
0361 GACTCGATCG ATATGCGCTT TGTGAAGCAC CACTACTACG ACTTTTTGCG CACCATGTAC 
0421 CAGCTGCTGC GGCGGGATGG CAAGCGGGTA AGGAGTCGGC CACGGAAGCA CCACAAGAAG 
0481 CAGCAGAGGA GCCAGAAAAA G 
 Assemble Data

5993R-1.IR_full       1   GCAAGCATGCAAACTTACGTGGCCAGCTTTGCGTATCTGAGGCGCCAGCAGATCCGCTGG 60
                          |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||
5993R-1.in silico     1   GCAA-CATGCAAACTTACGTGGCCAGCTTTGCGTATCTGAGGCGCCAGCAGATCCGCTGG 60


5993R-1.IR_full       61  GATCAGCGGTCCATCACCCGCGAGTCCAGCACCGCCCGCGAGCTGCGCGAGCTGCTCCTG 120
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
5993R-1.in silico     61  GATCAGCGGTCCATCACCCGCGAGTCCAGCACCGCCCGCGAGCTGCGCGAGCTGCTCCTG 120


5993R-1.IR_full       121 AGCTCGCGGCGCATCCTCTGCGAGCTGGAGACAGCCGTCAACCAGACGCAGAGTCCGCGC 180
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
5993R-1.in silico     121 AGCTCGCGGCGCATCCTCTGCGAGCTGGAGACAGCCGTCAACCAGACGCAGAGTCCGCGC 180


5993R-1.IR_full       181 CAGAAGCAGCGGCGCAGTGGTGCGGCGGTCACAGCAGTTGGCGGCACCACCATGCTGGGT 240
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
5993R-1.in silico     181 CAGAAGCAGCGGCGCAGTGGTGCGGCGGTCACAGCAGTTGGCGGCACCACCATGCTGGGT 240


5993R-1.IR_full       241 CAGCAGCTGCCACAGATCTCGCGTCTCGAGATGAACAAGCGTTTGAAGCTGCGCTCCAAG 300
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
5993R-1.in silico     241 CAGCAGCTGCCACAGATCTCGCGTCTCGAGATGAACAAGCGTTTGAAGCTGCGCTCCAAG 300


5993R-1.IR_full       301 ACGAGTGGGCCCGGTATGGGTGGTGCTGCTTCCAGTGCATCCATGGCGGCGGGCGAGGCG 360
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
5993R-1.in silico     301 ACGAGTGGGCCCGGTATGGGTGGTGCTGCTTCCAGTGCATCCATGGCGGCGGGCGAGGCG 360


5993R-1.IR_full       361 GACTCGATCGATATGCGCTTTGTGAAGCACCACTACTACGACTTTTTGCGCACCATGTAC 420
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
5993R-1.in silico     361 GACTCGATCGATATGCGCTTTGTGAAGCACCACTACTACGACTTTTTGCGCACCATGTAC 420


5993R-1.IR_full       421 CAGCTGCTGCGGCGGGATGGCAAGCGGGTAAGGAGTCGGCCACGGAAGCACCACAAGAAG 480
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
5993R-1.in silico     421 CAGCTGCTGCGGCGGGATGGCAAGCGGGTAAGGAGTCGGCCACGGAAGCACCACAAGAAG 480


5993R-1.IR_full       481 CAGCAGAGGAGCCAGAAAAAG 501
                          |||||||||||||||||||||
5993R-1.in silico     481 CAGCAGAGGAGCCAGAAAAAG 501

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_080356.2  CG5993-RA (os), mRNA 
0.2   NM_135767.1  CG5682-RA (CG5682), mRNA 
0   NM_176155.1  CG33012-RB, transcript variant B (CG33012), mRNA 
0   NM_176154.1  CG33012-RA, transcript variant A (CG33012), mRNA 
0   NM_135391.2  CG13095-RA (CG13095), mRNA 
0   NM_176734.1  CG33206-RA, transcript variant A (l(1)G0168), mRNA 
0   NM_176735.1  CG33206-RB, transcript variant B (l(1)G0168), mRNA 
0   NM_136202.4  CG31678-RA (CG31678), mRNA 
0   NM_143006.1  CG13617-RA (CG13617), mRNA 
0   13  NM_167595.3  CG12348-RE, transcript variant E (Sh), mRNA 
0   13  NM_206775.1  CG12348-RG, transcript variant G (Sh), mRNA 
0   13  NM_078669.3  CG12348-RB, transcript variant B (Sh), mRNA 
0   12  NM_206774.1  CG12348-RF, transcript variant F (Sh), mRNA 
0   NM_166446.1  CG9696-RD, transcript variant D (dom), mRNA 
0   NM_080094.2  CG9696-RA, transcript variant A (dom), mRNA 
0   NM_080535.2  CG9774-RA (rok), mRNA 
0   NM_139491.1  CG1241-RA (Atg2), mRNA 
0   NM_141111.4  CG7145-RB, transcript variant B (CG7145), mRNA 
0   NM_168945.3  CG7145-RD, transcript variant D (CG7145), mRNA 
0   NM_168942.3  CG7145-RA, transcript variant A (CG7145), mRNA 
0   NM_170547.2  CG31003-RA (gskt), mRNA 
0   NM_057326.4  CG12212-RA, transcript variant A (peb), mRNA 
0   NM_001014722.1  CG12212-RB, transcript variant B (peb), mRNA 
0   NM_141731.1  CG3996-RA (CG3996), mRNA 
0   NM_132320.2  CG12124-RA (CG12124), mRNA 
0   NM_168304.1  CG5021-RB, transcript variant B (CG5021), mRNA 
0   NM_140013.2  CG5021-RA, transcript variant A (CG5021), mRNA 
0   NM_141674.2  CG9448-RA (CG9448), mRNA 
0   NM_139458.2  CG1317-RB (CG1317), mRNA 
0   NM_136423.1  CG11101-RA (pwn), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.