National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 5988R-3 
 Symbol upd2  Full Name unpaired 2 
 CG No CG5988  Old CG No CG5988 
 Synonyms Upd2, CG5988, cg5988, upd2, UPD2 
 Accession No (Link to NCBI) NM_133049.1 
 Inserted Chr. ll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
 Reference
[Please submit your publication]
Patel PH, Dutta D, Edgar BA.
Niche appropriation by Drosophila intestinal stem cell tumours.
Nat. Cell Biol. (2015) 17(9) 1182-92 [ PubMed ID = 26237646 ] [ RRC reference ]

Lee JH, Lee CW, Park SH, Choe KM.
Spatiotemporal regulation of cell fusion by JNK and JAK/STAT signaling during Drosophila wound healing.
J. Cell. Sci. (2017) 130(11) 1917-1928 [ PubMed ID = 28424232 ] [ RRC reference ]

Rajan A, Perrimon N.
Drosophila cytokine unpaired 2 regulates physiological homeostasis by remotely controlling insulin secretion.
Cell (2012) 151(1) 123-37 [ PubMed ID = 23021220 ] [ RRC reference ]

Zhai Z, Kondo S, Ha N, Boquete JP, Brunner M, Ueda R, Lemaitre B.
Accumulation of differentiating intestinal stem cell progenies drives tumorigenesis.
Nat Commun (2015) 6 10219 [ PubMed ID = 26690827 ] [ RRC reference ]

Iatsenko I, Boquete JP, Lemaitre B.
Microbiota-Derived Lactate Activates Production of Reactive Oxygen Species by the Intestinal NADPH Oxidase Nox and Shortens Drosophila Lifespan.
Immunity (2018) 49(5) 929-942.e5 [ PubMed ID = 30446385 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgGCAGCCAGCCAACAGAGCCAA 
 Primer Seq. 3'
aatctagaggtaccCTGCTATCGCTGAGGCTCTCG 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 GCAGCCAGCC AACAGAGCCA AAGCAGCCGC AGCAGCAGGA GTGCACACAG CAGCTGGAGC 
0061 TGCCACAGCC GGCAGGTGCT GCTAGTGATC ATGATCCTGA GCGTCGTGAT GCCATTCACC 
0121 AAGGCGCGAC ACTTGCGCGA CCAGGTGGCA CTGGACTACG CCTACGACGA GGACAACTCC 
0181 GGCCGATCTT CCTCGTCGTC ATCGTCATCC TCATCATCGG GTGGCGACAT CCTGCCCGCC 
0241 TTCGATGTCA ATCCGTATCG CGGTCTGGCC GATAGCTTCG GCGAGGGCAG CTACGACAGT 
0301 GATATGAGTC TCAGCGAGAG TAGCTACGAG GAGATCGCCC AGGCGGCCAT CCGGGCTGCC 
0361 AGGCGGNGAG ATGCGCCGTC AGAGGACGCG ACACNGCGcG CAGCCACAAC CTGCGACTCT 
0421 TCTCCGGCAA ATCAGAGATC CCGGAGTGGG AGAACCCGTG CGGAGGCACC TACACGCCCG 
0481 ACGAGAGCCT CAGCGATAAG GGGCAG 
 in silico PCR Fragment
0001 GCAGCCAGCC AACAGAGCCA AAGCAGCCGC AGCAGCAGGA GTGCACACAG CAGCTGGAGC 
0061 TGCCACAGCC GGCAGGTGCT GCTAGTGATC ATGATCCTGA GCGTCGTGAT GCCATTCACC 
0121 AAGGCGCGAC ACTTGCGCGA CCAGGTGGCA CTGGACTACG CCTACGACGA GGACAACTCC 
0181 GGCCGATCTT CCTCGTCGTC ATCGTCATCC TCATCATCGG GTGGCGACAT CCTGCCCGCC 
0241 TTCGATGTCA ATCCGTATCG CGGTCTGGCC GATAGCTTCG GCGAGGGCAG CTACGACAGT 
0301 GATATGAGTC TCAGCGAGAG TAGCTACGAG GAGATCGCCC AGGCGGCCAT CCGGGCTGCC 
0361 AGGCGG-GAG ATGCGCCGTC AGAGGACGCG ACAC-GCGCG CAGCCACAAC CTGCGACTCT 
0421 TCTCCGGCAA ATCAGAGATC CCGGAGTGGG AGAACCCGTG CGGAGGCACC TACACGCCCG 
0481 ACGAGAGCCT CAGCGATA-- --GCAG 
 Assemble Data

5988R-3.IR_full       1   GCAGCCAGCCAACAGAGCCAAAGCAGCCGCAGCAGCAGGAGTGCACACAGCAGCTGGAGC 60
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
5988R-3.in silico     1   GCAGCCAGCCAACAGAGCCAAAGCAGCCGCAGCAGCAGGAGTGCACACAGCAGCTGGAGC 60


5988R-3.IR_full       61  TGCCACAGCCGGCAGGTGCTGCTAGTGATCATGATCCTGAGCGTCGTGATGCCATTCACC 120
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
5988R-3.in silico     61  TGCCACAGCCGGCAGGTGCTGCTAGTGATCATGATCCTGAGCGTCGTGATGCCATTCACC 120


5988R-3.IR_full       121 AAGGCGCGACACTTGCGCGACCAGGTGGCACTGGACTACGCCTACGACGAGGACAACTCC 180
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
5988R-3.in silico     121 AAGGCGCGACACTTGCGCGACCAGGTGGCACTGGACTACGCCTACGACGAGGACAACTCC 180


5988R-3.IR_full       181 GGCCGATCTTCCTCGTCGTCATCGTCATCCTCATCATCGGGTGGCGACATCCTGCCCGCC 240
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
5988R-3.in silico     181 GGCCGATCTTCCTCGTCGTCATCGTCATCCTCATCATCGGGTGGCGACATCCTGCCCGCC 240


5988R-3.IR_full       241 TTCGATGTCAATCCGTATCGCGGTCTGGCCGATAGCTTCGGCGAGGGCAGCTACGACAGT 300
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
5988R-3.in silico     241 TTCGATGTCAATCCGTATCGCGGTCTGGCCGATAGCTTCGGCGAGGGCAGCTACGACAGT 300


5988R-3.IR_full       301 GATATGAGTCTCAGCGAGAGTAGCTACGAGGAGATCGCCCAGGCGGCCATCCGGGCTGCC 360
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
5988R-3.in silico     301 GATATGAGTCTCAGCGAGAGTAGCTACGAGGAGATCGCCCAGGCGGCCATCCGGGCTGCC 360


5988R-3.IR_full       361 AGGCGGNGAGATGCGCCGTCAGAGGACGCGACACNGCGCGCAGCCACAACCTGCGACTCT 420
                          |||||| ||||||||||||||||||||||||||| |||||||||||||||||||||||||
5988R-3.in silico     361 AGGCGG-GAGATGCGCCGTCAGAGGACGCGACAC-GCGCGCAGCCACAACCTGCGACTCT 420


5988R-3.IR_full       421 TCTCCGGCAAATCAGAGATCCCGGAGTGGGAGAACCCGTGCGGAGGCACCTACACGCCCG 480
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
5988R-3.in silico     421 TCTCCGGCAAATCAGAGATCCCGGAGTGGGAGAACCCGTGCGGAGGCACCTACACGCCCG 480


5988R-3.IR_full       481 ACGAGAGCCTCAGCGATAAGGGGCAG 506
                          ||||||||||||||||||    ||||
5988R-3.in silico     481 ACGAGAGCCTCAGCGATA----GCAG 506

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  11  NM_133049.1  CG5988-RA (upd2), mRNA 
1.03   NM_136862.1  CG8271-RA (CG8271), mRNA 
0.82   19  NM_139371.1  CG13917-RA (CG13917), mRNA 
0.41   20  NM_135786.1  CG6108-RA (CG6108), mRNA 
0.2   NM_167634.1  CG7088-RB, transcript variant B (bnb), mRNA 
0.2   NM_078682.2  CG7088-RC, transcript variant C (bnb), mRNA 
0.2   NM_167633.1  CG7088-RA, transcript variant A (bnb), mRNA 
0.2   NM_167635.1  CG7088-RD, transcript variant D (bnb), mRNA 
0   11  12  13  NM_135892.2  CG4185-RA (NC2beta), mRNA 
0   36  128  NM_168401.1  CG6611-RC, transcript variant C (ect), mRNA 
0   36  118  NM_168400.1  CG6611-RB, transcript variant B (ect), mRNA 
0   36  118  NM_079967.4  CG6611-RA, transcript variant A (ect), mRNA 
0   24  89  NM_135392.3  CG13096-RA (CG13096), mRNA 
0   14  19  NM_132877.1  CG8958-RA (CG8958), mRNA 
0   12  NM_165024.1  CG31856-RA (CG31856), mRNA 
0   26  69  NM_167521.2  CG32575-RA, transcript variant A (hang), mRNA 
0   24  53  NM_167387.1  CG32611-RB (CG32611), mRNA 
0   22  57  NM_167520.2  CG32575-RB, transcript variant B (hang), mRNA 
0   20  96  NM_176556.1  CG33106-RA, transcript variant A (mask), mRNA 
0   20  89  NM_176557.1  CG33106-RB, transcript variant B (mask), mRNA 
0   30  NM_166314.1  CG12758-RA, transcript variant A (sano), mRNA 
0   30  NM_166315.1  CG12758-RB, transcript variant B (sano), mRNA 
0   20  NM_079064.2  CG12758-RD, transcript variant D (sano), mRNA 
0   20  NM_166316.1  CG12758-RC, transcript variant C (sano), mRNA 
0   10  NM_134748.2  CG5423-RA (robo3), mRNA 
0   37  148  NM_131975.3  CG32767-RA, transcript variant A (CG32767), mRNA 
0   37  148  NM_206628.1  CG32767-RB, transcript variant B (CG32767), mRNA 
0   22  NM_057617.3  CG10497-RA, transcript variant A (Sdc), mRNA 
0   39  NM_136553.2  CG8639-RA (Cirl), mRNA 
0   NM_142698.1  CG3353-RA (CG3353), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.