National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 5974R-3 
 Symbol pll  Full Name pelle 
 CG No CG5974  Old CG No CG5974 
 Synonyms CG5974, PELLE/IL-1, p11, pll 
 Accession No (Link to NCBI) NM_057623.3 
 Inserted Chr. ll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
 Reference
[Please submit your publication]
Heckscher ES, Fetter RD, Marek KW, Albin SD, Davis GW.
NF-kappaB, IkappaB, and IRAK control glutamate receptor density at the Drosophila NMJ.
Neuron (2007) 55(6) 859-73 [ PubMed ID = 17880891 ] [ RRC reference ]

Cho Y, Lai CM, Lin KY, Hsu HJ.
A Targeted RNAi Screen Reveals Drosophila Female-Sterile Genes That Control the Size of Germline Stem Cell Niche During Development.
G3 (Bethesda) (2018) 8(7) 2345-2354 [ PubMed ID = 29764959 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgAGGCGCAGGCCCAAAACCAAG 
 Primer Seq. 3'
aatctagaggtaccCTCCTCCGTTGCCGTTGTGCT 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 AGGCGCAGGC CCAAAACCAA GCGAATGGCA ACAGGACCAG GTCCGCGTTC CCACTTGGAC 
0061 AACACAATGG CCATCCGACT GCTGCCGTTG CCCGTGCGAG CCCAGCTATG TGCCCACTTG 
0121 GATGCCCTAG ACGTATGGCA ACANGCTGGC CACGGCCGTA AAACTCTATC CCGACCAGGT 
0181 GGAGCAGATA AGCAGCCAGA NAGCAGCGTG GCCGCTCAGC CTCCAATGAG TTCCTCAACA 
0241 TTTGGGGCGG TCAGTACAAT CACACGGTGC AAACATTGTT TGCTTTGTTC AAAAAATTGA 
0301 AGCTTCATAA CGCCATGCGT CTGATCAAAG ATTACGTTAG CGAGGATCTG CACAAGTACA 
0361 TACCGAGGAG CGTGCCCACC ATCAGCGAGC TGCGcGCTGC TCCCGATTCC AGTGCCAAAG 
0421 TAAACAACGG CCCGCCGTTT CCCTCCTCCT CGGGCGTCAG CAACTCAAAC AACAATCGCA 
0481 CCAGCACAAC GGCAACGGAG GAG 
 in silico PCR Fragment
0001 AGGCGCAGGC CCAAAACCAA GCGAATGGCA ACAGGACCAG GT-CGCGTTC CCACTTGGAC 
0061 AACACAATGG CCATCCGACT GCTGCCGTTG CCCGTGCGAG CCCAGCTATG TGCCCACTTG 
0121 GATGCCCTAG ACGTATGGCA ACA-GCTGGC CACGGCCGTA AAACTCTATC CCGACCAGGT 
0181 GGAGCAGATA AGCAGCCAGA -AGCAGCGTG GCCGCTCAGC CTCCAATGAG TTCCTCAACA 
0241 TTTGGGGCGG TCAGTACAAT CACACGGTGC AAACATTGTT TGCTTTGTTC AAAAAATTGA 
0301 AGCTTCATAA CGCCATGCGT CTGATCAAAG ATTACGTTAG CGAGGATCTG CACAAGTACA 
0361 TACCGAGGAG CGTGCCCACC ATCAGCGAGC TGCGCGCTGC TCCCGATTCC AGTGCCAAAG 
0421 TAAACAACGG CCCGCCGTTT CCCTCCTCCT CGGGCGTCAG CAACTCAAAC AACAATCGCA 
0481 CCAGCACAAC GGCAACGGAG GAG 
 Assemble Data

5974R-3.IR_full       1   AGGCGCAGGCCCAAAACCAAGCGAATGGCAACAGGACCAGGTCCGCGTTCCCACTTGGAC 60
                          |||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||
5974R-3.in silico     1   AGGCGCAGGCCCAAAACCAAGCGAATGGCAACAGGACCAGGT-CGCGTTCCCACTTGGAC 60


5974R-3.IR_full       61  AACACAATGGCCATCCGACTGCTGCCGTTGCCCGTGCGAGCCCAGCTATGTGCCCACTTG 120
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
5974R-3.in silico     61  AACACAATGGCCATCCGACTGCTGCCGTTGCCCGTGCGAGCCCAGCTATGTGCCCACTTG 120


5974R-3.IR_full       121 GATGCCCTAGACGTATGGCAACANGCTGGCCACGGCCGTAAAACTCTATCCCGACCAGGT 180
                          ||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||
5974R-3.in silico     121 GATGCCCTAGACGTATGGCAACA-GCTGGCCACGGCCGTAAAACTCTATCCCGACCAGGT 180


5974R-3.IR_full       181 GGAGCAGATAAGCAGCCAGANAGCAGCGTGGCCGCTCAGCCTCCAATGAGTTCCTCAACA 240
                          |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||
5974R-3.in silico     181 GGAGCAGATAAGCAGCCAGA-AGCAGCGTGGCCGCTCAGCCTCCAATGAGTTCCTCAACA 240


5974R-3.IR_full       241 TTTGGGGCGGTCAGTACAATCACACGGTGCAAACATTGTTTGCTTTGTTCAAAAAATTGA 300
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
5974R-3.in silico     241 TTTGGGGCGGTCAGTACAATCACACGGTGCAAACATTGTTTGCTTTGTTCAAAAAATTGA 300


5974R-3.IR_full       301 AGCTTCATAACGCCATGCGTCTGATCAAAGATTACGTTAGCGAGGATCTGCACAAGTACA 360
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
5974R-3.in silico     301 AGCTTCATAACGCCATGCGTCTGATCAAAGATTACGTTAGCGAGGATCTGCACAAGTACA 360


5974R-3.IR_full       361 TACCGAGGAGCGTGCCCACCATCAGCGAGCTGCGCGCTGCTCCCGATTCCAGTGCCAAAG 420
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
5974R-3.in silico     361 TACCGAGGAGCGTGCCCACCATCAGCGAGCTGCGCGCTGCTCCCGATTCCAGTGCCAAAG 420


5974R-3.IR_full       421 TAAACAACGGCCCGCCGTTTCCCTCCTCCTCGGGCGTCAGCAACTCAAACAACAATCGCA 480
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
5974R-3.in silico     421 TAAACAACGGCCCGCCGTTTCCCTCCTCCTCGGGCGTCAGCAACTCAAACAACAATCGCA 480


5974R-3.IR_full       481 CCAGCACAACGGCAACGGAGGAG 503
                          |||||||||||||||||||||||
5974R-3.in silico     481 CCAGCACAACGGCAACGGAGGAG 503

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_057623.3  CG5974-RA (pll), mRNA 
0.2   NM_136939.2  CG8831-RA (CG8831), mRNA 
0   NM_166940.1  CG32796-RB, transcript variant B (CG32796), mRNA 
0   NM_166941.1  CG32796-RA, transcript variant A (CG32796), mRNA 
0   NM_137342.2  CG30460-RC, transcript variant C (CG30460), mRNA 
0   NM_206148.1  CG30460-RD, transcript variant D (CG30460), mRNA 
0   NM_206149.1  CG30460-RA, transcript variant A (CG30460), mRNA 
0   NM_206150.1  CG30460-RB, transcript variant B (CG30460), mRNA 
0   NM_176439.1  CG33104-RA (eca), mRNA 
0   NM_176440.1  CG33105-RA (p24-2), mRNA 
0   NM_078731.2  CG3166-RB, transcript variant B (aop), mRNA 
0   NM_164987.1  CG14945-RB, transcript variant B (CG14945), mRNA 
0   NM_135697.1  CG14945-RA, transcript variant A (CG14945), mRNA 
0   NM_139718.2  CG10594-RA (spo), mRNA 
0   NM_078999.2  CG3830-RA (vg), mRNA 
0   NM_135859.1  CG17341-RA (CG17341), mRNA 
0   NM_140353.1  CG14120-RA (CG14120), mRNA 
0   NM_206067.1  CG1429-RF, transcript variant F (Mef2), mRNA 
0   NM_139640.2  CG18314-RA, transcript variant A (DopEcR), mRNA 
0   NM_001014559.1  CG18314-RC, transcript variant C (DopEcR), mRNA 
0   NM_001014560.1  CG18314-RB, transcript variant B (DopEcR), mRNA 
0   NM_057673.2  CG1429-RA, transcript variant A (Mef2), mRNA 
0   NM_057670.2  CG1429-RC, transcript variant C (Mef2), mRNA 
0   NM_057672.2  CG1429-RD, transcript variant D (Mef2), mRNA 
0   NM_057671.2  CG1429-RB, transcript variant B (Mef2), mRNA 
0   NM_169479.1  CG10120-RA, transcript variant A (Men), mRNA 
0   NM_080141.2  CG10120-RB, transcript variant B (Men), mRNA 
0   NM_080083.3  CG7004-RA, transcript variant A (fwd), mRNA 
0   NM_167826.1  CG7004-RB, transcript variant B (fwd), mRNA 
0   NM_167827.1  CG7004-RC, transcript variant C (fwd), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.