National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 5974R-1 
 Symbol pll  Full Name pelle 
 CG No CG5974  Old CG No CG5974 
 Synonyms CG5974, PELLE/IL-1, p11, pll 
 Accession No (Link to NCBI) NM_057623.3 
 Inserted Chr. ll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees semi-lethal 
 Map Viewer
[Please submit your publication]
Heckscher ES, Fetter RD, Marek KW, Albin SD, Davis GW.
NF-kappaB, IkappaB, and IRAK control glutamate receptor density at the Drosophila NMJ.
Neuron (2007) 55(6) 859-73 [ PubMed ID = 17880891 ] [ RRC reference ]

Neyen C, Bretscher AJ, Binggeli O, Lemaitre B.
Methods to study Drosophila immunity.
Methods (2014) 68(1) 116-28 [ PubMed ID = 24631888 ] [ RRC reference ]

Cho Y, Lai CM, Lin KY, Hsu HJ.
A Targeted RNAi Screen Reveals Drosophila Female-Sterile Genes That Control the Size of Germline Stem Cell Niche During Development.
G3 (Bethesda) (2018) 8(7) 2345-2354 [ PubMed ID = 29764959 ] [ RRC reference ]  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
 Primer Seq. 3'
 Predicted Fragment Size
 IR fragment full Seq
 in silico PCR Fragment
 Assemble Data

                          |||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| silico     1   AGGCGCAGGCCCAAAACCAAGCGAATGGCAACAGGACCAGGT-CGCGTTCCCACTTGGAC 60

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     61  AACACAATGGCCATCCGACTGCTGCCGTTGCCCGTGCGAGCCCAGCTATGTGCCCACTTG 120

                          ||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| silico     121 GATGCCCTAGACGTATGGCAACA-GCTGGCCACGGCCGTAAAACTCTATCCCGACCAGGT 180

                          |||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| silico     181 GGAGCAGATAAGCAGCCAGA-AGCAGCGTGGCCGCTCAGCCTCCAATGAGTTCCTCAACA 240

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     241 TTTGGGGCGGTCAGTACAATCACACGGTGCAAACATTGTTTGCTTTGTTCAAAAAATTGA 300

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     301 AGCTTCATAACGCCATGCGTCTGATCAAAGATTACGTTAGCGAGGATCTGCACAAGTACA 360

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     361 TACCGAGGAGCGTGCCCACCATCAGCGAGCTGCGCGCTGCTCCCGATTCCAGTGCCAAAG 420

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     421 TAAACAACGGCCCGCCGTTTCCCTCCTCCTCGGGCGTCAGCAACTCAAACAACAATCGCA 480

5974R-1.IR_full       481 CCAGCACAACGGCAACGGAGGAG 503
                          ||||||||||||||||||||||| silico     481 CCAGCACAACGGCAACGGAGGAG 503

 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_057623.3  CG5974-RA (pll), mRNA 
0.2   NM_136939.2  CG8831-RA (CG8831), mRNA 
0   NM_166940.1  CG32796-RB, transcript variant B (CG32796), mRNA 
0   NM_166941.1  CG32796-RA, transcript variant A (CG32796), mRNA 
0   NM_137342.2  CG30460-RC, transcript variant C (CG30460), mRNA 
0   NM_206148.1  CG30460-RD, transcript variant D (CG30460), mRNA 
0   NM_206149.1  CG30460-RA, transcript variant A (CG30460), mRNA 
0   NM_206150.1  CG30460-RB, transcript variant B (CG30460), mRNA 
0   NM_176439.1  CG33104-RA (eca), mRNA 
0   NM_176440.1  CG33105-RA (p24-2), mRNA 
0   NM_078731.2  CG3166-RB, transcript variant B (aop), mRNA 
0   NM_164987.1  CG14945-RB, transcript variant B (CG14945), mRNA 
0   NM_135697.1  CG14945-RA, transcript variant A (CG14945), mRNA 
0   NM_139718.2  CG10594-RA (spo), mRNA 
0   NM_078999.2  CG3830-RA (vg), mRNA 
0   NM_135859.1  CG17341-RA (CG17341), mRNA 
0   NM_140353.1  CG14120-RA (CG14120), mRNA 
0   NM_206067.1  CG1429-RF, transcript variant F (Mef2), mRNA 
0   NM_139640.2  CG18314-RA, transcript variant A (DopEcR), mRNA 
0   NM_001014559.1  CG18314-RC, transcript variant C (DopEcR), mRNA 
0   NM_001014560.1  CG18314-RB, transcript variant B (DopEcR), mRNA 
0   NM_057673.2  CG1429-RA, transcript variant A (Mef2), mRNA 
0   NM_057670.2  CG1429-RC, transcript variant C (Mef2), mRNA 
0   NM_057672.2  CG1429-RD, transcript variant D (Mef2), mRNA 
0   NM_057671.2  CG1429-RB, transcript variant B (Mef2), mRNA 
0   NM_169479.1  CG10120-RA, transcript variant A (Men), mRNA 
0   NM_080141.2  CG10120-RB, transcript variant B (Men), mRNA 
0   NM_080083.3  CG7004-RA, transcript variant A (fwd), mRNA 
0   NM_167826.1  CG7004-RB, transcript variant B (fwd), mRNA 
0   NM_167827.1  CG7004-RC, transcript variant C (fwd), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.