National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 5940R-1 
 Symbol CycA  Full Name Cyclin A 
 CG No CG5940  Old CG No CG5940 
 Synonyms cycA, DmcycA, 1449/05, 1329/16, 0545/13, 0521/06, 0245/34, 0104/07, 0046/23, 0040/24, 0033/02, S(rux)3B, l(3)183, rsg11, l(3)rsg11, l(3)neo114, l(3)j3C8, l(3)68Ea, l(3)03946, hari, CG5940, anon-WO0140519.128, CycA 
 Accession No (Link to NCBI) NM_079306.2 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
 Reference
[Please submit your publication]
Vaccaro A, Kaplan Dor Y, Nambara K, Pollina EA, Lin C, Greenberg ME, Rogulja D.
Sleep Loss Can Cause Death through Accumulation of Reactive Oxygen Species in the Gut.
Cell (2020) 181(6) 1307-1328.e15 [ PubMed ID = 32502393 ] [ RRC reference ]

Rogulja D, Young MW.
Control of sleep by cyclin A and its regulator.
Science (2012) 335(6076) 1617-21 [ PubMed ID = 22461610 ] [ RRC reference ]

Ohhara Y, Nakamura A, Kato Y, Yamakawa-Kobayashi K.
Chaperonin TRiC/CCT supports mitotic exit and entry into endocycle in Drosophila.
PLoS Genet. (2019) 15(4) e1008121 [ PubMed ID = 31034473 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgGAGGTCGGTGAGTTTGTCTTC 
 Primer Seq. 3'
aatctagaggtaccTAAGCCTCACAGAGCTGATCG 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 GAGGTCGGTG AGTTTGTCTT CCTCACCGAC GACAGTTACA CCAAGGCGCA GGTGCTACGC 
0061 ATGGAGCAGG TTATCTTGAA GATTCTCTCC TTCGATCTGT GCACACCGAC TGCTTACGTC 
0121 TTCATCAACA CCTATGCTGT ACTTTGCGAC ATGCCTGAGA AGCTGAAGTA CATGACGCTG 
0181 TATATTTCCG AGTTGTCGCA TCATGGAGGG AGAAACGTAC TTGCAATATT TGCCATCACT 
0241 TATGTCATCC GCTTCAGTCG CACTGGCGCG TCACATTTGT GGGCATGGAG ATGTGGACGC 
0301 CAAGGCTGGA GGAAGGATCA CGACTTACAA GCTGGAGGAC CTAAAAACGG TTGTGTTGCA 
0361 TCTGTGTCAC ACCCACAAAA CGGCAAAGGA GCTCAACACG CAGGCCATGC GGGAAAAGTA 
0421 CAATAGAGAC ACTTACAAGA AGGTGGCTAT GATGGAATCC GTTGAGATGA GCAAGGACGA 
0481 CTTCGATCAG CTCTGTGAGG CTTA 
 in silico PCR Fragment
0001 GAGGTCGGTG AGTTTGTCTT CCTCACCGAC GACAGTTACA CCAAGGCGCA GGTGCTACGC 
0061 ATGGAGCAGG TTATCTTGAA GATTCTCTCC TTCGATCTGT GCACACCGAC TGCTTACGTC 
0121 TTCATCAACA CCTATGCTGT ACTTTGCGAC ATGCCTGAGA AGCTGAAGTA CATGACGCTG 
0181 TATATTTCCG AGTTGTCGC- TCATGGAGGG AGAAACGTAC TTGCAATATT TGCCATCACT 
0241 TATGTCATCC GCTTCAGTCG CACTGGCGCG TCACATTT-T GGGCATGGAG ATGTGGACGC 
0301 CAAGGCTGGA GGA--GATCA CGACTTACAA GCTGGAGGAC CTAAAAACGG TTGTGTTGCA 
0361 TCTGTGTCAC ACCCACAAAA CGGCAAAGGA GCTCAACACG CAGGCCATGC GGGAAAAGTA 
0421 CAATAGAGAC ACTTACAAGA AGGTGGCTAT GATGGAATCC GTTGAGATGA GCAAGGACGA 
0481 CTTCGATCAG CTCTGTGAGG CTTA 
 Assemble Data

5940R-1.IR_full       1   GAGGTCGGTGAGTTTGTCTTCCTCACCGACGACAGTTACACCAAGGCGCAGGTGCTACGC 60
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
5940R-1.in silico     1   GAGGTCGGTGAGTTTGTCTTCCTCACCGACGACAGTTACACCAAGGCGCAGGTGCTACGC 60


5940R-1.IR_full       61  ATGGAGCAGGTTATCTTGAAGATTCTCTCCTTCGATCTGTGCACACCGACTGCTTACGTC 120
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
5940R-1.in silico     61  ATGGAGCAGGTTATCTTGAAGATTCTCTCCTTCGATCTGTGCACACCGACTGCTTACGTC 120


5940R-1.IR_full       121 TTCATCAACACCTATGCTGTACTTTGCGACATGCCTGAGAAGCTGAAGTACATGACGCTG 180
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
5940R-1.in silico     121 TTCATCAACACCTATGCTGTACTTTGCGACATGCCTGAGAAGCTGAAGTACATGACGCTG 180


5940R-1.IR_full       181 TATATTTCCGAGTTGTCGCATCATGGAGGGAGAAACGTACTTGCAATATTTGCCATCACT 240
                          ||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||
5940R-1.in silico     181 TATATTTCCGAGTTGTCGC-TCATGGAGGGAGAAACGTACTTGCAATATTTGCCATCACT 240


5940R-1.IR_full       241 TATGTCATCCGCTTCAGTCGCACTGGCGCGTCACATTTGTGGGCATGGAGATGTGGACGC 300
                          |||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||
5940R-1.in silico     241 TATGTCATCCGCTTCAGTCGCACTGGCGCGTCACATTT-TGGGCATGGAGATGTGGACGC 300


5940R-1.IR_full       301 CAAGGCTGGAGGAAGGATCACGACTTACAAGCTGGAGGACCTAAAAACGGTTGTGTTGCA 360
                          |||||||||||||  |||||||||||||||||||||||||||||||||||||||||||||
5940R-1.in silico     301 CAAGGCTGGAGGA--GATCACGACTTACAAGCTGGAGGACCTAAAAACGGTTGTGTTGCA 360


5940R-1.IR_full       361 TCTGTGTCACACCCACAAAACGGCAAAGGAGCTCAACACGCAGGCCATGCGGGAAAAGTA 420
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
5940R-1.in silico     361 TCTGTGTCACACCCACAAAACGGCAAAGGAGCTCAACACGCAGGCCATGCGGGAAAAGTA 420


5940R-1.IR_full       421 CAATAGAGACACTTACAAGAAGGTGGCTATGATGGAATCCGTTGAGATGAGCAAGGACGA 480
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
5940R-1.in silico     421 CAATAGAGACACTTACAAGAAGGTGGCTATGATGGAATCCGTTGAGATGAGCAAGGACGA 480


5940R-1.IR_full       481 CTTCGATCAGCTCTGTGAGGCTTA 504
                          ||||||||||||||||||||||||
5940R-1.in silico     481 CTTCGATCAGCTCTGTGAGGCTTA 504

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_079306.2  CG5940-RA, transcript variant A (CycA), mRNA 
100   482  NM_168483.1  CG5940-RB, transcript variant B (CycA), mRNA 
0   NM_134500.2  CG14224-RA (CG14224), mRNA 
0   NM_136206.1  CG2617-RA (CG2617), mRNA 
0   12  NM_143367.2  CG10011-RA (CG10011), mRNA 
0   70  NM_144448.2  CG1915-RC, transcript variant C (sls), mRNA 
0   NM_164696.1  CG31635-RA (CG31635), mRNA 
0   NM_140411.1  CG17368-RA (CG17368), mRNA 
0   NM_142664.1  CG15696-RA (CG15696), mRNA 
0   NM_141762.2  CG14692-RA (CG14692), mRNA 
0   NM_001043261.1  CG34157-RG, transcript variant G (Dys), mRNA 
0   NM_001043258.1  CG34157-RA, transcript variant A (Dys), mRNA 
0   NM_001043259.1  CG34157-RC, transcript variant C (Dys), mRNA 
0   NM_001043257.1  CG34157-RH, transcript variant H (Dys), mRNA 
0   NM_001043263.1  CG34157-RF, transcript variant F (Dys), mRNA 
0   NM_001043262.1  CG34157-RE, transcript variant E (Dys), mRNA 
0   NM_001043260.1  CG34157-RD, transcript variant D (Dys), mRNA 
0   NM_001043256.1  CG34157-RB, transcript variant B (Dys), mRNA 
0   NM_168072.1  CG15010-RA, transcript variant A (ago), mRNA 
0   NM_168073.1  CG15010-RB, transcript variant B (ago), mRNA 
0   NM_079198.2  CG15010-RC, transcript variant C (ago), mRNA 
0   NM_141746.3  CG14680-RA, transcript variant A (Cyp12e1), mRNA 
0   NM_169344.2  CG14680-RB, transcript variant B (Cyp12e1), mRNA 
0   NM_142780.2  CG13855-RA (CG13855), mRNA 
0   NM_137497.2  CG10924-RA (CG10924), mRNA 
0   NM_143176.2  CG14354-RA (CG14354), mRNA 
0   NM_168110.2  CG10671-RB, transcript variant B (CG10671), mRNA 
0   NM_139687.2  CG10671-RA, transcript variant A (CG10671), mRNA 
0   NM_165820.1  CG13211-RB, transcript variant B (CG13211), mRNA 
0   NM_136824.2  CG13211-RA, transcript variant A (CG13211), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.