National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock temporarily unavailable request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 5909R-2 
 Symbol CG5909  Full Name CG5909 
 CG No CG5909  Old CG No CG5909 
 Synonyms c-SP8, SP8, CG5909 
 Accession No (Link to NCBI) NM_143287.1 
 Inserted Chr. ll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
 Reference
[Please submit your publication]
Kambris Z, Brun S, Jang IH, Nam HJ, Romeo Y, Takahashi K, Lee WJ, Ueda R, Lemaitre B.
Drosophila immunity: a large-scale in vivo RNAi screen identifies five serine proteases required for Toll activation.
Curr Biol (2006) 16(8) 808-13 [ PubMed ID = 16631589 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgTGTCTGCGGCGATTCGACTTG 
 Primer Seq. 3'
aatctagaggtaccGTGGCGTTCGCTGATGAGGCT 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 TGTCTGCGGC GATTCGACTT GGTCTGCTCT TGTGCATCTT GCCCCAGCTG GTCATCAGCC 
0061 AGAGCAGCTG CGTCACGCCG GCCCAAGCAG TCGGTCAGTG CATCCGATAC CAGGAGTGCC 
0121 CCTTCGTGCA GAAGATTCTC GGGATCTACG GTCGGAATAT ACCACGGAAA ATCCACAACC 
0181 AAATTAGTGA GATGCAGTGC AGGAGCACTA CGAATACGAG GGACTTCCAT CTTTGTTGCC 
0241 CCAACGAGGC ACCCCCTCAA TCCAATCAGG AGTCGCAGAG GAAGGTCGTT CGATCGGAGG 
0301 GCGGAAATCT GAACCGGTAT GATCGCCAGG GTCTGCAGCT GCTGAACTCG GTGACCAACT 
0361 GCGGCAACAA GGGCAATCCC AAGGTGAGCG GTGGAAAGAC GGCCAGGCCA GGCGACTTTC 
0421 CCTGGGTGGC CCTGCTCAAG TACAAGATCA ACGATCCGCG TCCATTCCGC TGCGgCGGCA 
0481 GCCTCATCAG CGAACGNCAC  
 in silico PCR Fragment
0001 TGTCTGCGGC GATTCGACTT GGACTGCTCT TGTGCATCTT GCCCCAGCTG GTCATCAGCC 
0061 AGAGCAGCTG CGTCACGCCG GCCCAAGCAG CCGGTCAGTG CATCCGATAC CAGGAGTGCC 
0121 CCTTCGTGCA GAAGATTCTC GGGATCTACG GTCGGAATAT ACCACGGAAA ATCCACAACC 
0181 AAATTAGTGA GATGCAGTGC AGGAGCACTA CGAATACGAG GGACTTCCAT CTTTGTTGCC 
0241 CCAACGAGGC ACCTCCTCAA TCCAATCAGG AGTCGCAGAG GAAGGTCGTG CGATCGGAGG 
0301 GCGGAAATCT GAACCGGTAT GATCGCCAGG GTCTGCAGCT GCTGAACTCG GTGACCAACT 
0361 GCGGCAACAA GGGCAATCCC AAGGTGAGCG GTGGAAAGAC GGCCAGGCCA GGCGACTTTC 
0421 CCTGGGTGGC CCTGCTCAAG TACAAGATCA ACGATCCGCG TCCATTCCGC TGCGGCGGCA 
0481 GCCTCATCAG CGAACGCCAC  
 Assemble Data

5909R-2.IR_full       1   TGTCTGCGGCGATTCGACTTGGTCTGCTCTTGTGCATCTTGCCCCAGCTGGTCATCAGCC 60
                          |||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||
5909R-2.in silico     1   TGTCTGCGGCGATTCGACTTGGACTGCTCTTGTGCATCTTGCCCCAGCTGGTCATCAGCC 60


5909R-2.IR_full       61  AGAGCAGCTGCGTCACGCCGGCCCAAGCAGTCGGTCAGTGCATCCGATACCAGGAGTGCC 120
                          |||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||
5909R-2.in silico     61  AGAGCAGCTGCGTCACGCCGGCCCAAGCAGCCGGTCAGTGCATCCGATACCAGGAGTGCC 120


5909R-2.IR_full       121 CCTTCGTGCAGAAGATTCTCGGGATCTACGGTCGGAATATACCACGGAAAATCCACAACC 180
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
5909R-2.in silico     121 CCTTCGTGCAGAAGATTCTCGGGATCTACGGTCGGAATATACCACGGAAAATCCACAACC 180


5909R-2.IR_full       181 AAATTAGTGAGATGCAGTGCAGGAGCACTACGAATACGAGGGACTTCCATCTTTGTTGCC 240
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
5909R-2.in silico     181 AAATTAGTGAGATGCAGTGCAGGAGCACTACGAATACGAGGGACTTCCATCTTTGTTGCC 240


5909R-2.IR_full       241 CCAACGAGGCACCCCCTCAATCCAATCAGGAGTCGCAGAGGAAGGTCGTTCGATCGGAGG 300
                          ||||||||||||| ||||||||||||||||||||||||||||||||||| ||||||||||
5909R-2.in silico     241 CCAACGAGGCACCTCCTCAATCCAATCAGGAGTCGCAGAGGAAGGTCGTGCGATCGGAGG 300


5909R-2.IR_full       301 GCGGAAATCTGAACCGGTATGATCGCCAGGGTCTGCAGCTGCTGAACTCGGTGACCAACT 360
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
5909R-2.in silico     301 GCGGAAATCTGAACCGGTATGATCGCCAGGGTCTGCAGCTGCTGAACTCGGTGACCAACT 360


5909R-2.IR_full       361 GCGGCAACAAGGGCAATCCCAAGGTGAGCGGTGGAAAGACGGCCAGGCCAGGCGACTTTC 420
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
5909R-2.in silico     361 GCGGCAACAAGGGCAATCCCAAGGTGAGCGGTGGAAAGACGGCCAGGCCAGGCGACTTTC 420


5909R-2.IR_full       421 CCTGGGTGGCCCTGCTCAAGTACAAGATCAACGATCCGCGTCCATTCCGCTGCGGCGGCA 480
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
5909R-2.in silico     421 CCTGGGTGGCCCTGCTCAAGTACAAGATCAACGATCCGCGTCCATTCCGCTGCGGCGGCA 480


5909R-2.IR_full       481 GCCTCATCAGCGAACGNCAC 500
                          |||||||||||||||| |||
5909R-2.in silico     481 GCCTCATCAGCGAACGCCAC 500

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_143287.1  CG5909-RA (CG5909), mRNA 
0   15  NM_057454.3  CG16720-RA, transcript variant A (5-HT1A), mRNA 
0   15  NM_166322.1  CG16720-RB, transcript variant B (5-HT1A), mRNA 
0   NM_164705.1  CG11325-RB, transcript variant B (GRHR), mRNA 
0   NM_141590.2  CG11964-RA (CG11964), mRNA 
0   NM_139949.2  CG7185-RA (CG7185), mRNA 
0   NM_176735.1  CG33206-RB, transcript variant B (l(1)G0168), mRNA 
0   NM_176734.1  CG33206-RA, transcript variant A (l(1)G0168), mRNA 
0   NM_057374.2  CG3722-RA (shg), mRNA 
0   NM_057941.3  CG5227-RA, transcript variant A (sdk), mRNA 
0   NM_134314.2  CG5227-RB, transcript variant B (sdk), mRNA 
0   NM_134315.2  CG5227-RD, transcript variant D (sdk), mRNA 
0   NM_057942.3  CG5227-RC, transcript variant C (sdk), mRNA 
0   NM_132646.1  CG12724-RA (CG12724), mRNA 
0   NM_165196.1  CG31739-RA (CG31739), mRNA 
0   10  NM_057539.3  CG9310-RA, transcript variant A (Hnf4), mRNA 
0   NM_137479.2  CG5164-RA (GstE1), mRNA 
0   NM_167189.2  CG32705-RA (CG32705), mRNA 
0   NM_164834.1  CG9310-RC, transcript variant C (Hnf4), mRNA 
0   NM_141002.1  CG11451-RA (CG11451), mRNA 
0   NM_164833.1  CG9310-RB, transcript variant B (Hnf4), mRNA 
0   10  NM_169616.2  CG4154-RA, transcript variant A (Gyc88E), mRNA 
0   10  NM_142167.2  CG4154-RC, transcript variant C (Gyc88E), mRNA 
0   10  NM_001043246.1  CG4154-RD, transcript variant D (Gyc88E), mRNA 
0   NM_167649.1  CG32533-RA (CG32533), mRNA 
0   NM_139630.1  CG1316-RA (CG1316), mRNA 
0   NM_133088.1  CG6632-RA (Ing3), mRNA 
0   NM_136559.2  CG8738-RA (CG8738), mRNA 
0   NM_136770.1  CG12342-RA, transcript variant A (CG12342), mRNA 
0   NM_165800.1  CG12342-RB, transcript variant B (CG12342), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.