National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 5896R-2 
 Symbol grass  Full Name Gram-positive Specific Serine protease 
 CG No CG5896  Old CG No CG5896 
 Synonyms grass, CG5896, c-SP1, SP1, SP2 
 Accession No (Link to NCBI) NM_170318.1 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees viable 
 Map Viewer
 Reference
[Please submit your publication]
Umemori M, Habara O, Iwata T, Maeda K, Nishinoue K, Okabe A, Takemura M, Takahashi K, Saigo K, Ueda R, Adachi-Yamada T.
RNAi-mediated knockdown showing impaired cell survival in Drosophila wing imaginal disc.
Gene Regul Syst Bio (2009) 3 11-20 [ PubMed ID = 19838331 ] [ RRC reference ]

Kambris Z, Brun S, Jang IH, Nam HJ, Romeo Y, Takahashi K, Lee WJ, Ueda R, Lemaitre B.
Drosophila immunity: a large-scale in vivo RNAi screen identifies five serine proteases required for Toll activation.
Curr Biol (2006) 16(8) 808-13 [ PubMed ID = 16631589 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgCCAGTTACCTGCAGAAGGCAC 
 Primer Seq. 3'
aatctagaggtaccCTGGAAGGGGACGCTCCTGTT 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 CCAGTTACCT GCAGAAGGCA CTCTGCGGCG AGTTCAATGG AGTGCGCCAC TTCTGCTGCC 
0061 CCTCAGCCAA CATTCAGCAC AACTCCAAGG TGATGAGCCT GTTCAAGGAC GAAAACTTCG 
0121 ACTGCGGCAA CTTCCTCAGC CAAAGAGTGT CCAATGGCTA CGAGGTGAAG CTCTCCTCCA 
0181 GACCCTGGAT GGCCCTGCTC CGTTATCAGC AGTTTGGAGA GTCCAGATTC CTTTGCGGCG 
0241 GAGCTATGAT ATCCGAGCGC TACATCCTGA CTGCTGCTCA CTGTGTCCAC GGTCTTCAGA 
0301 ACGATCTTTA TGAGATCCGG CTCGGCGAGC ACCGCATCTC TACGGAGGAG GATTGCCGGC 
0361 AGCAGGGACG CAAGAAGAAA TGTGCCCCGC CAGTTGTGAA TGTGGGCATT GAGAAGCATC 
0421 TGATTCATGA GAAGTACGAC GCCCGCCACA TCATGCATGA CATAGCTCTC CTGAAGCTCA 
0481 ACAGGAGCGT CCCCTTCCAG  
 in silico PCR Fragment
0001 CCAGTTACCT GCAGAAGGCA CTCTGCGGCG AGTTCAATGG AGTGCGCCAC TTCTGCTGCC 
0061 CCTCAGCCAA CATTCAGCAC AACTCCAAGG TGATGAGCCT GTTCAAGGAC GAAAACTTTG 
0121 ACTGCGGCAA CTTCCTCAGC CAAAGAGTGT CCAATGGCTA CGAGGTGAAG CTCTCCTCCA 
0181 GACCCTGGAT GGCCCTGCTC CGTTATCAGC AGTTTGGAGA GTCCAGATTC CTTTGCGGCG 
0241 GAGCTATGAT ATCCGAGCGC TACATCCTGA CTGCTGCTCA CTGTGTCCAC GGTCTTCAGA 
0301 ACGATCTTTA TGAGATCCGG CTCGGCGAGC ACCGCATCTC TACGGAGGAG GATTGCCGGC 
0361 AGCAGGGACG CAAGAAGAAA TGTGCCCCGC CAGTTGTGAA TGTGGGCATT GAGAAGCATC 
0421 TGATTCATGA GAAGTACGAC GCCCGCCACA TCATGCATGA CATAGCTCTC CTGAAGCTCA 
0481 ACAGGAGCGT CCCCTTCCAG  
 Assemble Data

5896R-2.IR_full       1   CCAGTTACCTGCAGAAGGCACTCTGCGGCGAGTTCAATGGAGTGCGCCACTTCTGCTGCC 60
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
5896R-2.in silico     1   CCAGTTACCTGCAGAAGGCACTCTGCGGCGAGTTCAATGGAGTGCGCCACTTCTGCTGCC 60


5896R-2.IR_full       61  CCTCAGCCAACATTCAGCACAACTCCAAGGTGATGAGCCTGTTCAAGGACGAAAACTTCG 120
                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
5896R-2.in silico     61  CCTCAGCCAACATTCAGCACAACTCCAAGGTGATGAGCCTGTTCAAGGACGAAAACTTTG 120


5896R-2.IR_full       121 ACTGCGGCAACTTCCTCAGCCAAAGAGTGTCCAATGGCTACGAGGTGAAGCTCTCCTCCA 180
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
5896R-2.in silico     121 ACTGCGGCAACTTCCTCAGCCAAAGAGTGTCCAATGGCTACGAGGTGAAGCTCTCCTCCA 180


5896R-2.IR_full       181 GACCCTGGATGGCCCTGCTCCGTTATCAGCAGTTTGGAGAGTCCAGATTCCTTTGCGGCG 240
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
5896R-2.in silico     181 GACCCTGGATGGCCCTGCTCCGTTATCAGCAGTTTGGAGAGTCCAGATTCCTTTGCGGCG 240


5896R-2.IR_full       241 GAGCTATGATATCCGAGCGCTACATCCTGACTGCTGCTCACTGTGTCCACGGTCTTCAGA 300
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
5896R-2.in silico     241 GAGCTATGATATCCGAGCGCTACATCCTGACTGCTGCTCACTGTGTCCACGGTCTTCAGA 300


5896R-2.IR_full       301 ACGATCTTTATGAGATCCGGCTCGGCGAGCACCGCATCTCTACGGAGGAGGATTGCCGGC 360
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
5896R-2.in silico     301 ACGATCTTTATGAGATCCGGCTCGGCGAGCACCGCATCTCTACGGAGGAGGATTGCCGGC 360


5896R-2.IR_full       361 AGCAGGGACGCAAGAAGAAATGTGCCCCGCCAGTTGTGAATGTGGGCATTGAGAAGCATC 420
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
5896R-2.in silico     361 AGCAGGGACGCAAGAAGAAATGTGCCCCGCCAGTTGTGAATGTGGGCATTGAGAAGCATC 420


5896R-2.IR_full       421 TGATTCATGAGAAGTACGACGCCCGCCACATCATGCATGACATAGCTCTCCTGAAGCTCA 480
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
5896R-2.in silico     421 TGATTCATGAGAAGTACGACGCCCGCCACATCATGCATGACATAGCTCTCCTGAAGCTCA 480


5896R-2.IR_full       481 ACAGGAGCGTCCCCTTCCAG 500
                          ||||||||||||||||||||
5896R-2.in silico     481 ACAGGAGCGTCCCCTTCCAG 500

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_170318.1  CG5896-RA, transcript variant A (CG5896), mRNA 
100   482  NM_143286.1  CG5896-RB, transcript variant B (CG5896), mRNA 
0.2   NM_166398.1  CG18065-RA, transcript variant A (CG18065), mRNA 
0.2   NM_001032270.1  CG13430-RB, transcript variant B (CG13430), mRNA 
0.2   NM_001032271.1  CG13430-RA, transcript variant A (CG13430), mRNA 
0.2   NM_078753.2  CG8867-RA, transcript variant A (Jon25Bi), mRNA 
0.2   NM_001038784.1  CG8867-RB, transcript variant B (Jon25Bi), mRNA 
0   13  NM_176575.1  CG33103-RA, transcript variant A (Ppn), mRNA 
0   12  NM_176574.1  CG33103-RB, transcript variant B (Ppn), mRNA 
0   NM_079220.1  CG6457-RA (yip7), mRNA 
0   NM_206275.2  CG12605-RA, transcript variant A (CG12605), mRNA 
0   NM_206274.2  CG12605-RC, transcript variant C (CG12605), mRNA 
0   NM_139588.3  CG12605-RB, transcript variant B (CG12605), mRNA 
0   NM_139755.2  CG6467-RA (Jon65Aiv), mRNA 
0   NM_164704.1  CG11326-RE, transcript variant E (Tsp), mRNA 
0   NM_164702.1  CG11326-RC, transcript variant C (Tsp), mRNA 
0   NM_164703.1  CG11326-RD, transcript variant D (Tsp), mRNA 
0   NM_167231.3  CG17255-RB, transcript variant B (CG17255), mRNA 
0   NM_132403.3  CG17255-RA, transcript variant A (CG17255), mRNA 
0   NM_001014526.1  CG33528-RE, transcript variant E (CG33528), mRNA 
0   NM_001014524.1  CG33528-RC, transcript variant C (CG33528), mRNA 
0   NM_001014525.1  CG33528-RD, transcript variant D (CG33528), mRNA 
0   NM_139504.2  CG1893-RA (CG1893), mRNA 
0   NM_143408.2  CG1401-RA (cul-5), mRNA 
0   NM_166925.1  CG4199-RA, transcript variant A (CG4199), mRNA 
0   NM_134532.2  CG9581-RA (CG9581), mRNA 
0   NM_166922.1  CG4199-RB, transcript variant B (CG4199), mRNA 
0   NM_130620.2  CG4199-RD, transcript variant D (CG4199), mRNA 
0   NM_166923.1  CG4199-RC, transcript variant C (CG4199), mRNA 
0   NM_166921.1  CG4199-RE, transcript variant E (CG4199), mRNA 
 Wing Disc
GFP
Puc
Caspase
DAPI
Merge
Figure
JNK signal
N
DB
DC
++ 
DM
VM
+- 
VB
 
Caspase-3 signal
N
++  
DB
++ 
DC
++ 
DM
++ 
VM
VB
++ 
Dcompartment   Penetrance
++     

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.