National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 5848R-3 
 Symbol cact  Full Name cactus 
 CG No CG5848  Old CG No CG5848 
 Synonyms CACT, CG5848, dip6, n(2)k17003, BG:DS02740.15, cac, fs(2)ltoRN48, cact 
 Accession No (Link to NCBI) NM_165152.1 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
 Reference
[Please submit your publication]
Wu C, Chen Y, Wang F, Chen C, Zhang S, Li C, Li W, Wu S, Xue L.
Pelle Modulates dFoxO-Mediated Cell Death in Drosophila.
PLoS Genet. (2015) 11(10) e1005589 [ PubMed ID = 26474173 ] [ RRC reference ]

Wu C, Chen C, Dai J, Zhang F, Chen Y, Li W, Pastor-Pareja JC, Xue L.
Toll pathway modulates TNF-induced JNK-dependent cell death in Drosophila.
Open Biol (2015) 5(7) 140171 [ PubMed ID = 26202785 ] [ RRC reference ]

Zhou B, Lindsay SA, Wasserman SA.
Alternative NF-κB Isoforms in the Drosophila Neuromuscular Junction and Brain.
PLoS ONE (2015) 10(7) e0132793 [ PubMed ID = 26167685 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgCCAACAAAAGCAGCGGAGGCA 
 Primer Seq. 3'
aatctagaggtaccTGTTCGCCGCGACTGACCAAA 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 CCAACAAAAG CAGCGGAGGC AGCAACAAAG GCAACAGCAA CAAGTGACTG CAGCTGCAgC 
0061 GCTGCCAGTG TTGAGCAGCG CGCCCCCTCA AACGCGGCTA ACCCCTCGTC CTCACTAGCC 
0121 ACTAGCGGTA AAATTGGCGG CAAAACACAA GATCAAACGG CCGCCATTAA CAAGCAAAAG 
0181 GAATTTGCCG TGCCAAACGA AACCAGTGAT TCGGGCTTCA TCTCCGGCCC GCAATCCTCG 
0241 CAGATCTTCA GCGAGGAGAT AGTCCCCGAT AGCGAGGAAC AGGATAAGGA TCAGCAGGAG 
0301 TCGGCACCCC AAAAGGAACA GCCCGTTGTC CTCGATTCCG GTATTATCGA CGAAGAAGAG 
0361 GATCAGGAGG AGCAGGAGAA AGAGGAGGAG CACCAGGACA CCACCACTGC CACCGCCGAT 
0421 TCAATGCGAC TCAAACACAG CGCGGACACA GGCATCCCAC AATGGACCGT CGAAAGCCAT 
0481 TTGGTCAGTC GCGGCGAACA  
 in silico PCR Fragment
0001 CCAACAAAAG CAGCGGAGGC AGCAACAAAG GCAACAGCAA CAAGTGACTG CAGCTGCAGC 
0061 GCTGCCAGTG TTGAGCAGCG CGCCCCCTCA AACGCGGCTA ACCCCTCGTC CTCACTAGCC 
0121 ACTAGCGGTA AAATTGGCGG CAAAACACAA GATCAAACGG CCGCCATTAA CAAGCAAAAG 
0181 GAATTTGCCG TGCCAAACGA AACCAGTGAT TCGGGCTTCA TCTCCGGCCC GCAATCCTCG 
0241 CAGATCTTCA GCGAGGAGAT AGTCCCCGAT AGCGAGGAAC AGGATAAGGA TCAGCAGGAG 
0301 TCGGCACCCC AAAAGGAACA GCCCGTTGTC CTCGATTCCG GTATTATCGA CGAAGAAGAG 
0361 GATCAGGAGG AGCAGGAGAA AGAGGAGGAG CACCAGGACA CCACCACTGC CACCGCCGAT 
0421 TCAATGCGAC TCAAACACAG CGCGGACACA GGCATCCCAC AATGGACCGT CGAAAGCCAT 
0481 TTGGTCAGTC GCGGCGAACA  
 Assemble Data

5848R-3.IR_full       1   CCAACAAAAGCAGCGGAGGCAGCAACAAAGGCAACAGCAACAAGTGACTGCAGCTGCAGC 60
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
5848R-3.in silico     1   CCAACAAAAGCAGCGGAGGCAGCAACAAAGGCAACAGCAACAAGTGACTGCAGCTGCAGC 60


5848R-3.IR_full       61  GCTGCCAGTGTTGAGCAGCGCGCCCCCTCAAACGCGGCTAACCCCTCGTCCTCACTAGCC 120
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
5848R-3.in silico     61  GCTGCCAGTGTTGAGCAGCGCGCCCCCTCAAACGCGGCTAACCCCTCGTCCTCACTAGCC 120


5848R-3.IR_full       121 ACTAGCGGTAAAATTGGCGGCAAAACACAAGATCAAACGGCCGCCATTAACAAGCAAAAG 180
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
5848R-3.in silico     121 ACTAGCGGTAAAATTGGCGGCAAAACACAAGATCAAACGGCCGCCATTAACAAGCAAAAG 180


5848R-3.IR_full       181 GAATTTGCCGTGCCAAACGAAACCAGTGATTCGGGCTTCATCTCCGGCCCGCAATCCTCG 240
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
5848R-3.in silico     181 GAATTTGCCGTGCCAAACGAAACCAGTGATTCGGGCTTCATCTCCGGCCCGCAATCCTCG 240


5848R-3.IR_full       241 CAGATCTTCAGCGAGGAGATAGTCCCCGATAGCGAGGAACAGGATAAGGATCAGCAGGAG 300
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
5848R-3.in silico     241 CAGATCTTCAGCGAGGAGATAGTCCCCGATAGCGAGGAACAGGATAAGGATCAGCAGGAG 300


5848R-3.IR_full       301 TCGGCACCCCAAAAGGAACAGCCCGTTGTCCTCGATTCCGGTATTATCGACGAAGAAGAG 360
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
5848R-3.in silico     301 TCGGCACCCCAAAAGGAACAGCCCGTTGTCCTCGATTCCGGTATTATCGACGAAGAAGAG 360


5848R-3.IR_full       361 GATCAGGAGGAGCAGGAGAAAGAGGAGGAGCACCAGGACACCACCACTGCCACCGCCGAT 420
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
5848R-3.in silico     361 GATCAGGAGGAGCAGGAGAAAGAGGAGGAGCACCAGGACACCACCACTGCCACCGCCGAT 420


5848R-3.IR_full       421 TCAATGCGACTCAAACACAGCGCGGACACAGGCATCCCACAATGGACCGTCGAAAGCCAT 480
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
5848R-3.in silico     421 TCAATGCGACTCAAACACAGCGCGGACACAGGCATCCCACAATGGACCGTCGAAAGCCAT 480


5848R-3.IR_full       481 TTGGTCAGTCGCGGCGAACA 500
                          ||||||||||||||||||||
5848R-3.in silico     481 TTGGTCAGTCGCGGCGAACA 500

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_057594.3  CG5848-RB, transcript variant B (cact), mRNA 
100   482  NM_057595.3  CG5848-RC, transcript variant C (cact), mRNA 
100   482  NM_165152.1  CG5848-RA, transcript variant A (cact), mRNA 
100   482  NM_205999.1  CG5848-RD, transcript variant D (cact), mRNA 
0.41   NM_132166.2  CG1999-RA (CG1999), mRNA 
0.41   NM_142267.2  CG5916-RA (CG5916), mRNA 
0.41   14  NM_169584.1  CG31330-RA (CG31330), mRNA 
0.41   NM_137231.2  CG8388-RA (CG8388), mRNA 
0   15  93  NM_133114.2  CG32541-RA (CG32541), mRNA 
0   NM_206714.1  CG5541-RB, transcript variant B (CG5541), mRNA 
0   NM_206715.1  CG5541-RA, transcript variant A (CG5541), mRNA 
0   NM_143364.1  CG12413-RA (CG12413), mRNA 
0   NM_176130.3  CG12052-RJ, transcript variant J (lola), mRNA 
0   NM_079581.2  CG6538-RA (TfIIFbeta), mRNA 
0   11  NM_141277.2  CG1172-RA (CG1172), mRNA 
0   14  71  NM_131975.3  CG32767-RA, transcript variant A (CG32767), mRNA 
0   14  71  NM_206628.1  CG32767-RB, transcript variant B (CG32767), mRNA 
0   NM_080097.2  CG6699-RA (beta'Cop), mRNA 
0   NM_132239.1  CG1632-RA (CG1632), mRNA 
0   25  NM_206091.1  CG7734-RD, transcript variant D (shn), mRNA 
0   25  NM_057375.3  CG7734-RA, transcript variant A (shn), mRNA 
0   25  NM_134279.2  CG7734-RB, transcript variant B (shn), mRNA 
0   25  NM_057376.2  CG7734-RC, transcript variant C (shn), mRNA 
0   13  NM_132068.1  CG15899-RB (Ca-alpha1T), mRNA 
0   21  NM_141072.2  CG7177-RA (CG7177), mRNA 
0   13  NM_206008.1  CG33316-RB, transcript variant B (CG33316), mRNA 
0   13  NM_206007.1  CG33316-RA, transcript variant A (CG33316), mRNA 
0   NM_206773.1  CG32556-RB, transcript variant B (CG32556), mRNA 
0   21  NM_132959.2  CG8949-RA (CG8949), mRNA 
0   NM_170325.1  CG31064-RA, transcript variant A (CG31064), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.