National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 5848R-3 
 Symbol cact  Full Name cactus 
 CG No CG5848  Old CG No CG5848 
 Synonyms CACT, CG5848, dip6, n(2)k17003, BG:DS02740.15, cac, fs(2)ltoRN48, cact 
 Accession No (Link to NCBI) NM_165152.1 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
[Please submit your publication]
Wang CH, Huang YC, Chen PY, Cheng YJ, Kao HH, Pi H, Chien CT.
USP5/Leon deubiquitinase confines postsynaptic growth by maintaining ubiquitin homeostasis through Ubiquilin.
Elife (2017) 6 [ PubMed ID = 28489002 ] [ RRC reference ]

Wu C, Chen Y, Wang F, Chen C, Zhang S, Li C, Li W, Wu S, Xue L.
Pelle Modulates dFoxO-Mediated Cell Death in Drosophila.
PLoS Genet. (2015) 11(10) e1005589 [ PubMed ID = 26474173 ] [ RRC reference ]

Wu C, Chen C, Dai J, Zhang F, Chen Y, Li W, Pastor-Pareja JC, Xue L.
Toll pathway modulates TNF-induced JNK-dependent cell death in Drosophila.
Open Biol (2015) 5(7) 140171 [ PubMed ID = 26202785 ] [ RRC reference ]

Zhou B, Lindsay SA, Wasserman SA.
Alternative NF-κB Isoforms in the Drosophila Neuromuscular Junction and Brain.
PLoS ONE (2015) 10(7) e0132793 [ PubMed ID = 26167685 ] [ RRC reference ]  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
 Primer Seq. 3'
 Predicted Fragment Size
 IR fragment full Seq
 in silico PCR Fragment
 Assemble Data

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     1   CCAACAAAAGCAGCGGAGGCAGCAACAAAGGCAACAGCAACAAGTGACTGCAGCTGCAGC 60

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     61  GCTGCCAGTGTTGAGCAGCGCGCCCCCTCAAACGCGGCTAACCCCTCGTCCTCACTAGCC 120

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     121 ACTAGCGGTAAAATTGGCGGCAAAACACAAGATCAAACGGCCGCCATTAACAAGCAAAAG 180

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     181 GAATTTGCCGTGCCAAACGAAACCAGTGATTCGGGCTTCATCTCCGGCCCGCAATCCTCG 240

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     241 CAGATCTTCAGCGAGGAGATAGTCCCCGATAGCGAGGAACAGGATAAGGATCAGCAGGAG 300

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     301 TCGGCACCCCAAAAGGAACAGCCCGTTGTCCTCGATTCCGGTATTATCGACGAAGAAGAG 360

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     361 GATCAGGAGGAGCAGGAGAAAGAGGAGGAGCACCAGGACACCACCACTGCCACCGCCGAT 420

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     421 TCAATGCGACTCAAACACAGCGCGGACACAGGCATCCCACAATGGACCGTCGAAAGCCAT 480

5848R-3.IR_full       481 TTGGTCAGTCGCGGCGAACA 500
                          |||||||||||||||||||| silico     481 TTGGTCAGTCGCGGCGAACA 500

 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_057594.3  CG5848-RB, transcript variant B (cact), mRNA 
100   482  NM_057595.3  CG5848-RC, transcript variant C (cact), mRNA 
100   482  NM_165152.1  CG5848-RA, transcript variant A (cact), mRNA 
100   482  NM_205999.1  CG5848-RD, transcript variant D (cact), mRNA 
0.41   NM_132166.2  CG1999-RA (CG1999), mRNA 
0.41   NM_142267.2  CG5916-RA (CG5916), mRNA 
0.41   14  NM_169584.1  CG31330-RA (CG31330), mRNA 
0.41   NM_137231.2  CG8388-RA (CG8388), mRNA 
0   15  93  NM_133114.2  CG32541-RA (CG32541), mRNA 
0   NM_206714.1  CG5541-RB, transcript variant B (CG5541), mRNA 
0   NM_206715.1  CG5541-RA, transcript variant A (CG5541), mRNA 
0   NM_143364.1  CG12413-RA (CG12413), mRNA 
0   NM_176130.3  CG12052-RJ, transcript variant J (lola), mRNA 
0   NM_079581.2  CG6538-RA (TfIIFbeta), mRNA 
0   11  NM_141277.2  CG1172-RA (CG1172), mRNA 
0   14  71  NM_131975.3  CG32767-RA, transcript variant A (CG32767), mRNA 
0   14  71  NM_206628.1  CG32767-RB, transcript variant B (CG32767), mRNA 
0   NM_080097.2  CG6699-RA (beta'Cop), mRNA 
0   NM_132239.1  CG1632-RA (CG1632), mRNA 
0   25  NM_206091.1  CG7734-RD, transcript variant D (shn), mRNA 
0   25  NM_057375.3  CG7734-RA, transcript variant A (shn), mRNA 
0   25  NM_134279.2  CG7734-RB, transcript variant B (shn), mRNA 
0   25  NM_057376.2  CG7734-RC, transcript variant C (shn), mRNA 
0   13  NM_132068.1  CG15899-RB (Ca-alpha1T), mRNA 
0   21  NM_141072.2  CG7177-RA (CG7177), mRNA 
0   13  NM_206008.1  CG33316-RB, transcript variant B (CG33316), mRNA 
0   13  NM_206007.1  CG33316-RA, transcript variant A (CG33316), mRNA 
0   NM_206773.1  CG32556-RB, transcript variant B (CG32556), mRNA 
0   21  NM_132959.2  CG8949-RA (CG8949), mRNA 
0   NM_170325.1  CG31064-RA, transcript variant A (CG31064), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.