National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
Notification of resumption of orders:

Orders have been suspended as a response to the COVID-19 infection, but it will be resumed today, May 11. However, we would like to set our organizational framework that prioritizes the maintenance of stocks for the time being. In addition, due to delays in delivery of postal items, it is expected that the flies you ordered will not reach you in normal period. We apologize for the inconvenience.

Thank you for your understanding.

NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock discarded request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 5802R-1 
 Symbol CG5802  Full Name CG5802 
 CG No CG5802  Old CG No CG5802 
 Synonyms unnamed, anon-EST:fe1H6, CG5802, anon-fast-evolving-1H6 
 Accession No (Link to NCBI)  
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
 Reference
[Please submit your publication]
Yamamoto-Hino M, Yoshida H, Ichimiya T, Sakamura S, Maeda M, Kimura Y, Sasaki N, Aoki-Kinoshita KF, Kinoshita-Toyoda A, Toyoda H, Ueda R, Nishihara S, Goto S.
Phenotype-based clustering of glycosylation-related genes by RNAi-mediated gene silencing.
Genes Cells (2015) 20(6) 521-42 [ PubMed ID = 25940448 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgGGTACAGACAGATGGATCCGT 
 Primer Seq. 3'
aatctagaggtaccTCATCATCTGCTGACCGGAAG 
 Predicted Fragment Size
500 
 IR fragment full Seq
 
 in silico PCR Fragment
 
 Assemble Data

5802R-1.IR full       1   GGTACAGACAGATGGATCCGTGGGAGAGCGCTTCACTTACGCCTTGGCCCTTGTTTGGGT 60
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
5802R-1.in silico     1   GGTACAGACAGATGGATCCGTGGGAGAGCGCTTCACTTACGCCTTGGCCCTTGTTTGGGT 60


5802R-1.IR full       61  GCAGTGCCTCTGCAACTATGTGTTTGCCAAGGTGCTGCTGACCATTAGGCCGCAAAAGGA 120
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
5802R-1.in silico     61  GCAGTGCCTCTGCAACTATGTGTTTGCCAAGGTGCTGCTGACCATTAGGCCGCAAAAGGA 120


5802R-1.IR full       121 GGACACCACCAACGCGGGCTCCTACGTGGCCTGTTCGCTGACCTATCTTCTGGCCATGGT 180
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
5802R-1.in silico     121 GGACACCACCAACGCGGGCTCCTACGTGGCCTGTTCGCTGACCTATCTTCTGGCCATGGT 180


5802R-1.IR full       181 CTCCACCAATATGGCCATGCGCTGGGTTCCCTATCCCACTGCTGTGGTAGGTAAATCCGC 240
                          |||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||
5802R-1.in silico     181 CTCCACCAATATGGCCATGCGCTGGGTTCCCTATCCCACTGCTGTGGTGGGTAAATCCGC 240


5802R-1.IR full       241 CAAGCCCATCCCCGTCATGATCCTGGGCGTGCTGATTGGTCGCAAATCCTACAGCTGGAC 300
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
5802R-1.in silico     241 CAAGCCCATCCCCGTCATGATCCTGGGCGTGCTGATTGGTCGCAAATCCTACAGCTGGAC 300


5802R-1.IR full       301 GCGCTATGCTTGCGTATTGACCATTGTCCTGGGAGTTATTCTCTTTATGTACAAGGAGGG 360
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
5802R-1.in silico     301 GCGCTATGCTTGCGTATTGACCATTGTCCTGGGAGTTATTCTCTTTATGTACAAGGAGGG 360


5802R-1.IR full       361 CAAGGTGTCCAATTTGCCGGCTGAGACCACGCTTCTCGGCGAGGTGCTGCTCTTCCTCAG 420
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
5802R-1.in silico     361 CAAGGTGTCCAATTTGCCGGCTGAGACCACGCTTCTCGGCGAGGTGCTGCTCTTCCTCAG 420


5802R-1.IR full       421 TTTGTCAATGGACGGATTGACTGGAGCCGTTCAGGAGCGCATCCGAGCGGCCAGCGCGCC 480
                          |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||
5802R-1.in silico     421 TTTGTCAATGGACGGATTGACTGGAGCCGTTCAGGAACGCATCCGAGCGGCCAGCGCGCC 480


5802R-1.IR full       481 TTCCGGTCAGCAGATGATGAGG 502
                          ||||||||||||||||||||  
5802R-1.in silico     481 TTCCGGTCAGCAGATGATGA-- 502

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100  490  NM_142692.1  CG5802-RA (CG5802), mRNA 
NM_132322.2  ric8a CG15797-RA (ric8a), mRNA 
NM_165777.2  mitochondrial carnitine palmitoyltransferase I CG12891-RB, transcript variant B (CPTI), mRNA 
NM_078961.3  mitochondrial carnitine palmitoyltransferase I CG12891-RA, transcript variant A (CPTI), mRNA 
NM_165776.1  CG11777-RA (CG11777), mRNA 
NM_140446.2  CG3919-RA (CG3919), mRNA 
NM_135489.2  CG5846-RA (CG5846), mRNA 
NM_206564.1  CG5794-RE, transcript variant E (CG5794), mRNA 
NM_170158.1  CG5794-RB, transcript variant B (CG5794), mRNA 
NM_143018.2  CG5794-RD, transcript variant D (CG5794), mRNA 
NM_001032400.1  CG9850-RB, transcript variant B (CG9850), mRNA 
NM_137983.3  CG9850-RA, transcript variant A (CG9850), mRNA 
NM_169222.2  CG31462-RA (CG31462), mRNA 
NM_057920.3  Stromalin CG3423-RA (SA), mRNA 
NM_143453.1  CG7582-RA (CG7582), mRNA 
NM_001014606.1  CG1161-RB, transcript variant B (CG1161), mRNA 
NM_141271.2  CG1161-RA, transcript variant A (CG1161), mRNA 
NM_206496.1  CG14869-RB, transcript variant B (CG14869), mRNA 
NM_169659.2  CG14869-RA, transcript variant A (CG14869), mRNA 
NM_132230.2  slipper CG2272-RA (slpr), mRNA 
NM_079449.2  Adenylyl cyclase 76E CG7978-RA (Ac76E), mRNA 
NM_169704.1  CG32855-RA (CG32855), mRNA 
NM_168521.1  CG32108-RA (CG32108), mRNA 
10  NM_167595.3  Shaker CG12348-RE, transcript variant E (Sh), mRNA 
NM_167594.2  Shaker CG12348-RC, transcript variant C (Sh), mRNA 
NM_140127.1  CG8072-RA (CG8072), mRNA 
NM_169947.1  SNF4/AMP-activated protein kinase gamma subunit CG17299-RF, transcript variant F (SNF4Agamma), mRNA 
NM_165533.1  dappled CG1624-RA, transcript variant A (dpld), mRNA 
NM_165534.1  dappled CG1624-RB, transcript variant B (dpld), mRNA 
NM_080033.2  dappled CG1624-RC, transcript variant C (dpld), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.