National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock discarded request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 5771R-2 
 Symbol Rab11  Full Name Rab-protein 11 
 CG No CG5771  Old CG No CG5771 
 Synonyms Dm Rab11, rab11, AAF55850, DmRab11, rab-11, CG5771, Drab11, l(3)j2D1, l(3)93Bi, DRab11, DRAB11, rlr7, Rab-r11, Rab11 
 Accession No (Link to NCBI)  
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
 Reference
[Please submit your publication]
Jia D, Soylemez M, Calvin G, Bornmann R, Bryant J, Hanna C, Huang YC, Deng WM.
A large-scale in vivo RNAi screen to identify genes involved in Notch-mediated follicle cell differentiation and cell cycle switches.
Sci Rep (2015) 5 12328 [ PubMed ID = 26205122 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgGAGTTTGCAACGCGCAGCATA 
 Primer Seq. 3'
aatctagaggtaccCAGCACTGTTTGCGCACATCG 
 Predicted Fragment Size
500 
 IR fragment full Seq
 
 in silico PCR Fragment
 
 Assemble Data

5771R-2.IR full        1   AGTTTGCAAC-CGCANN-TAGAGGTCGATGGCAAAACAATTAAAGCGCAAATCTGGGAT 59
                           |||||||||| ||||   |||||||||||||||||||||||||||||||||||||||||
5771R-2.in silico      1   AGTTTGCAACGCGCAGCATAGAGGTCGATGGCAAAACAATTAAAGCGCAAATCTGGGAT 59


5771R-2.IR full       61  ACGGCCGGCCAGNAGCGTTATCNC--CATCACCTCTGCCTACTACCGCGGTGCCGTGGGG 119
                          |||||||||||| ||||||||| |  ||||||||||||||||||||||||||||||||||
5771R-2.in silico     61  ACGGCCGGCCAGGAGCGTTATCGCGCCATCACCTCTGCCTACTACCGCGGTGCCGTGGGG 119


5771R-2.IR full       121 GCCCTGCTCGTCTATGACATTGCCAAGCATCTGACCTACGAGAACGTGGAGCGGTGGCTG 179
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
5771R-2.in silico     121 GCCCTGCTCGTCTATGACATTGCCAAGCATCTGACCTACGAGAACGTGGAGCGGTGGCTG 179


5771R-2.IR full       181 CGNGAATTGCGCGACCATGCCGACCAGAACATCGTCATCATGCTGGTGG-CAACAAGTCC 239
                          || |||||||||||||||||||||||||||||||||||||||||||||| ||||||||||
5771R-2.in silico     181 CGGGAATTGCGCGACCATGCCGACCAGAACATCGTCATCATGCTGGTGGGCAACAAGTCC 239


5771R-2.IR full       241 GACTTGCGNCACTTGCGCTCCGTGCCCACGNACGAGNNNAA--TGTTTGCCGAGNGCAAC 299
                          |||||||| ||||||||||||||||||||| |||||   ||  ||||||||||| |||||
5771R-2.in silico     241 GACTTGCGGCACTTGCGCTCCGTGCCCACGGACGAGGCGAAGCTGTTTGCCGAGCGCAAC 299


5771R-2.IR full       301 GNCTTGAGTTTCATAGAAACCTCGGCCCTNGACTCNACGAANGTTNAAACGGCATTCCAG 359
                          | ||||||||||||||||||||||||||| ||||| ||||| ||| ||||||||||||||
5771R-2.in silico     301 GGCTTGAGTTTCATAGAAACCTCGGCCCTCGACTCAACGAACGTTGAAACGGCATTCCAG 359


5771R-2.IR full       361 AACATACTCACAGAGATCTATCGCATTNTGTCGCAGAAACANATCAGAGATTCNCCGGAA 419
                          ||||||||||||||||||||||||||| ||||||||||||| ||||||||| | ||||||
5771R-2.in silico     361 AACATACTCACAGAGATCTATCGCATTGTGTCGCAGAAACAGATCAGAGATCCGCCGGAA 419


5771R-2.IR full       421 GGCGACGTCATCCGCCCGTCGAACGTGGAGCCCATCGACGTAAAGCCGACTGTCACCGCC 479
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
5771R-2.in silico     421 GGCGACGTCATCCGCCCGTCGAACGTGGAGCCCATCGACGTAAAGCCGACTGTCACCGCC 479


5771R-2.IR full       481 GATGTGCGCAAACAGTGCTG 499
                          ||||||||||||||||||||
5771R-2.in silico     481 GATGTGCGCAAACAGTGCTG 499

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.