National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 5723R-1 
 Symbol Ten-m  Full Name Tenascin major 
 CG No CG5723  Old CG No CG5723 
 Synonyms Ten-mc, odz/ten-m, ten-m, CT16449, odz, ten(m), 5301, 2017, l(3)05309, unnamed, ten[m], Ten[m], l(3)00844, odd(Oz), l(3)rP126, l(3)rL201, l(3)rJ307, l(3)05301, Ten79E, CG11452, CG5723, BcDNA:AT25108, Ten-m, Tenascin major, odd-Oz, odd Oz, tenascin major, Odz, ten-m/odz 
 Accession No (Link to NCBI) NM_079491.2 
 Inserted Chr. ll 
 Insertional Mutation  lethal 
 Phenotype induced by Act5C-GAL4 at 28 degrees viable 
 Map Viewer
 Reference
[Please submit your publication]
Hong W, Mosca TJ, Luo L.
Teneurins instruct synaptic partner matching in an olfactory map.
Nature (2012) 484(7393) 201-7 [ PubMed ID = 22425994 ] [ RRC reference ]

Perkins AD, Lee MJ, Tanentzapf G.
The systematic identification of cytoskeletal genes required for Drosophila melanogaster muscle maintenance.
Sci Data (2014) 1 140002 [ PubMed ID = 25977760 ] [ RRC reference ]  
 Comment balanced with SM6a, Cy 
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgACGAGTACCAGCACTTGGCCC 
 Primer Seq. 3'
aatctagaggtaccGGCGAAGAGCACCGAGATGGA 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 ACGAGTACCA GCACTTGGCC CACCGTCCGC CGGAcACgGC CAACAACACA GCGCAgcGGA 
0061 CACACGGAAG ACAAGGCTTC CTCCTGGAAG GAGTCACGCC AACGGCACCA CCGGATGTTC 
0121 CGCCGCGTAA TCCGACAATG AGTCGCATGC AAAATGGTCG TTTAACCGTT AACAATCCCA 
0181 ATGACGCTGA CTTTGAGCCA TCTTGTTTGG TGCGAACGCC ATCGGGCAAC GTTTACATTC 
0241 CTAGTGGAAA TCTAAACATC AACAAGGGAT CACCCATCGA CTTCAAGAGC GGCTCGGCCT 
0301 GCTCCACACC CACGAAGGAT ACGCTGAAGG GCTACGAGCG GAGCACGCAG GGCTGCATGG 
0361 GTCCTGTGCT GCCGCAGCGC AGCGTCATGA ACGGACTGCC CGCACACCAC TACTCGGCGC 
0421 CGATGAACTT CCGCAAGGAC CTGGTCGCGC GCTGCTCCTC GCCGTGGTTC GGTATAGGAT 
0481 CCATCTCGGT GNTCTTCGCC  
 in silico PCR Fragment
0001 ACGAGTACCA GCACTTGGCC CACCGTCCGC CGGACACGGC CAACAACACA GCGCAGCGGA 
0061 CACACGGAAG ACAAGGCTTC CTCCTGGAAG GAGTCACGCC AACGGCACCA CCGGATGTTC 
0121 CGCCGCGTAA TCCGACAATG AGTCGCATGC AAAATGGTCG TTTAACCGTT AACAATCCCA 
0181 ATGACGCTGA CTTTGAGCCA TCTTGTTTGG TGCGAACGCC ATCGGGCAAC GTTTACATTC 
0241 CTAGTGGAAA TCTAAACATC AACAAGGGAT CACCCATCGA CTTCAAGAGC GGCTCGGCCT 
0301 GCTCCACACC CACGAAGGAT ACGCTGAAGG GCTACGAGCG GAGCACGCAG GGCTGCATGG 
0361 GTCCTGTGCT GCCGCAGCGC AGCGTCATGA ACGGACTGCC CGCACACCAC TACTCGGCGC 
0421 CGATGAACTT CCGCAAGGAC CTGGTCGCGC GCTGCTCCTC GCCGTGGTTC GGTATAGGAT 
0481 CCATCTCGGT GCTCTTCGCC  
 Assemble Data

5723R-1.IR_full       1   ACGAGTACCAGCACTTGGCCCACCGTCCGCCGGACACGGCCAACAACACAGCGCAGCGGA 60
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
5723R-1.in silico     1   ACGAGTACCAGCACTTGGCCCACCGTCCGCCGGACACGGCCAACAACACAGCGCAGCGGA 60


5723R-1.IR_full       61  CACACGGAAGACAAGGCTTCCTCCTGGAAGGAGTCACGCCAACGGCACCACCGGATGTTC 120
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
5723R-1.in silico     61  CACACGGAAGACAAGGCTTCCTCCTGGAAGGAGTCACGCCAACGGCACCACCGGATGTTC 120


5723R-1.IR_full       121 CGCCGCGTAATCCGACAATGAGTCGCATGCAAAATGGTCGTTTAACCGTTAACAATCCCA 180
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
5723R-1.in silico     121 CGCCGCGTAATCCGACAATGAGTCGCATGCAAAATGGTCGTTTAACCGTTAACAATCCCA 180


5723R-1.IR_full       181 ATGACGCTGACTTTGAGCCATCTTGTTTGGTGCGAACGCCATCGGGCAACGTTTACATTC 240
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
5723R-1.in silico     181 ATGACGCTGACTTTGAGCCATCTTGTTTGGTGCGAACGCCATCGGGCAACGTTTACATTC 240


5723R-1.IR_full       241 CTAGTGGAAATCTAAACATCAACAAGGGATCACCCATCGACTTCAAGAGCGGCTCGGCCT 300
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
5723R-1.in silico     241 CTAGTGGAAATCTAAACATCAACAAGGGATCACCCATCGACTTCAAGAGCGGCTCGGCCT 300


5723R-1.IR_full       301 GCTCCACACCCACGAAGGATACGCTGAAGGGCTACGAGCGGAGCACGCAGGGCTGCATGG 360
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
5723R-1.in silico     301 GCTCCACACCCACGAAGGATACGCTGAAGGGCTACGAGCGGAGCACGCAGGGCTGCATGG 360


5723R-1.IR_full       361 GTCCTGTGCTGCCGCAGCGCAGCGTCATGAACGGACTGCCCGCACACCACTACTCGGCGC 420
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
5723R-1.in silico     361 GTCCTGTGCTGCCGCAGCGCAGCGTCATGAACGGACTGCCCGCACACCACTACTCGGCGC 420


5723R-1.IR_full       421 CGATGAACTTCCGCAAGGACCTGGTCGCGCGCTGCTCCTCGCCGTGGTTCGGTATAGGAT 480
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
5723R-1.in silico     421 CGATGAACTTCCGCAAGGACCTGGTCGCGCGCTGCTCCTCGCCGTGGTTCGGTATAGGAT 480


5723R-1.IR_full       481 CCATCTCGGTGNTCTTCGCC 500
                          ||||||||||| ||||||||
5723R-1.in silico     481 CCATCTCGGTGCTCTTCGCC 500

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_079491.2  CG5723-RB (Ten-m), mRNA 
0   NM_078857.2  CG5876-RA (heix), mRNA 
0   NM_140595.1  CG13054-RA (CG13054), mRNA 
0   NM_135030.2  CG2837-RB, transcript variant B (CG2837), mRNA 
0   NM_164602.1  CG2837-RC, transcript variant C (CG2837), mRNA 
0   NM_164601.1  CG2837-RA, transcript variant A (CG2837), mRNA 
0   NM_143334.1  CG12426-RA (CG12426), mRNA 
0   NM_139528.2  CG17569-RB, transcript variant B (gry), mRNA 
0   NM_168000.1  CG17569-RA, transcript variant A (gry), mRNA 
0   NM_165355.1  CG9256-RA, transcript variant A (Nhe2), mRNA 
0   NM_136244.2  CG9256-RB, transcript variant B (Nhe2), mRNA 
0   NM_132528.1  CG1886-RA (ATP7), mRNA 
0   NM_057849.3  CG3733-RA (Chd1), mRNA 
0   NM_136191.2  CG31688-RA (CG31688), mRNA 
0   NM_078777.2  CG4675-RA, transcript variant A (Ndae1), mRNA 
0   NM_164744.1  CG4675-RB, transcript variant B (Ndae1), mRNA 
0   NM_139912.3  CG7574-RA (bip1), mRNA 
0   NM_166311.1  CG15081-RA, transcript variant A (l(2)03709), mRNA 
0   NM_166312.1  CG15081-RC, transcript variant C (l(2)03709), mRNA 
0   NM_143773.2  CG15081-RB, transcript variant B (l(2)03709), mRNA 
0   NM_137076.1  CG6701-RA (CG6701), mRNA 
0   NM_001032239.1  CG33775-RA (CG33775), mRNA 
0   NM_141554.2  CG8032-RA (CG8032), mRNA 
0   NM_080021.2  CG2952-RA (Dox-A3), mRNA 
0   NM_078558.2  CG2155-RA (v), mRNA 
0   NM_137931.1  CG13541-RA (CG13541), mRNA 
0   NM_169955.2  CG10823-RB, transcript variant B (SIFR), mRNA 
0   NM_142709.2  CG10823-RA, transcript variant A (SIFR), mRNA 
0   NM_001031864.1  CG33950-RE, transcript variant E (trol), mRNA 
0   NM_142081.2  CG3172-RA (twf), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.