National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 5680R-1 
 Symbol bsk  Full Name basket 
 CG No CG5680  Old CG No CG5680 
 Synonyms JNK, DJNK, jnk, dJNK, DBSK/JNK, D-JNK, CG5680, DJNK/bsk, JNK/SAPK, SAPKa, D-junk, Bsk, Junk, bsk 
 Accession No (Link to NCBI) NM_164900.1 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
 Reference
[Please submit your publication]
Tsai CR, Anderson AE, Burra S, Jo J, Galko MJ.
Yorkie regulates epidermal wound healing in Drosophila larvae independently of cell proliferation and apoptosis.
Dev. Biol. (2017) [ PubMed ID = 28514643 ] [ RRC reference ]

Lee JH, Lee CW, Park SH, Choe KM.
Spatiotemporal regulation of cell fusion by JNK and JAK/STAT signaling during Drosophila wound healing.
J Cell Sci. (2017) [ PubMed ID = 28424232 ] [ RRC reference ]

Tiwari P, Kumar A, Das RN, Malhotra V, VijayRaghavan K.
A Tendon Cell Specific RNAi Screen Reveals Novel Candidates Essential for Muscle Tendon Interaction.
PLoS ONE (2015) 10(10) e0140976 [ PubMed ID = 26488612 ] [ RRC reference ]

Wang Y, Antunes M, Anderson AE, Kadrmas JL, Jacinto A, Galko MJ.
Integrin Adhesions Suppress Syncytium Formation in the Drosophila Larval Epidermis.
Curr. Biol. (2015) 25(17) 2215-27 [ PubMed ID = 26255846 ] [ RRC reference ]

Umetsu D, Dunst S, Dahmann C.
An RNA interference screen for genes required to shape the anteroposterior compartment boundary in Drosophila identifies the Eph receptor.
PLoS ONE (2014) 9(12) e114340 [ PubMed ID = 25473846 ] [ RRC reference ]

Brock AR, Wang Y, Berger S, Renkawitz-Pohl R, Han VC, Wu Y, Galko MJ.
Transcriptional regulation of Profilin during wound closure in Drosophila larvae.
J Cell Sci. (2012) 125(Pt 23) 5667-76 [ PubMed ID = 22976306 ] [ RRC reference ]

Gonda RL, Garlena RA, Stronach B.
Drosophila heat shock response requires the JNK pathway and phosphorylation of mixed lineage kinase at a conserved serine-proline motif.
PLoS ONE (2012) 7(7) e42369 [ PubMed ID = 22848763 ] [ RRC reference ]

Bangi E, Pitsouli C, Rahme LG, Cagan R, Apidianakis Y.
Immune response to bacteria induces dissemination of Ras-activated Drosophila hindgut cells.
EMBO Rep. (2012) 13(6) 569-76 [ PubMed ID = 22498775 ] [ RRC reference ]

Tsuzuki S, Ochiai M, Matsumoto H, Kurata S, Ohnishi A, Hayakawa Y.
Drosophila growth-blocking peptide-like factor mediates acute immune reactions during infectious and non-infectious stress.
Sci Rep (2012) 2 210 [ PubMed ID = 22355724 ] [ RRC reference ]

Doggett K, Grusche FA, Richardson HE, Brumby AM.
Loss of the Drosophila cell polarity regulator Scribbled promotes epithelial tissue overgrowth and cooperation with oncogenic Ras-Raf through impaired Hippo pathway signaling.
BMC Dev. Biol. (2011) 11 57 [ PubMed ID = 21955824 ] [ RRC reference ]

Lesch C, Jo J, Wu Y, Fish GS, Galko MJ.
A targeted UAS-RNAi screen in Drosophila larvae identifies wound closure genes regulating distinct cellular processes.
Genetics (2010) 186(3) 943-57 [ PubMed ID = 20813879 ] [ RRC reference ]

Neisch AL, Speck O, Stronach B, Fehon RG.
Rho1 regulates apoptosis via activation of the JNK signaling pathway at the plasma membrane.
J Cell Biol. (2010) 189(2) 311-23 [ PubMed ID = 20404112 ] [ RRC reference ]

Wu Y, Brock AR, Wang Y, Fujitani K, Ueda R, Galko MJ.
A blood-borne PDGF/VEGF-like ligand initiates wound-induced epidermal cell migration in Drosophila larvae.
Curr. Biol. (2009) 19(17) 1473-7 [ PubMed ID = 19646875 ] [ RRC reference ]

Mummery-Widmer JL, Yamazaki M, Stoeger T, Novatchkova M, Bhalerao S, Chen D, Dietzl G, Dickson BJ, Knoblich JA.
Genome-wide analysis of Notch signalling in Drosophila by transgenic RNAi.
Nature (2009) 458(7241) 987-92 [ PubMed ID = 19363474 ] [ RRC reference ]

Ishimaru S, Ueda R, Hinohara Y, Ohtani M, Hanafusa H.
PVR plays a critical role via JNK activation in thorax closure during Drosophila metamorphosis.
EMBO J. (2004) 23(20) 3984-94 [ PubMed ID = 15457211 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgCACCAACACTACACCGTCGAG 
 Primer Seq. 3'
aatctagaggtaccCGTGCCAGACCGAAATCCAAA 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 CACCAACACT ACACCGTCGA GGTgGGGGAC ACCAACTTCA CCATCCACAG TCGGTACATT 
0061 AATCTACGGC CCATAGGATC AGGTGCCCAA GGAATAGTAT GCGCCGCTTA CGATACTATC 
0121 ACCCAGCAAA ATGTGGCGAT TAAGAAACTA TCTCGACCAT TCCAAAATGT AACCCATGCC 
0181 AAGCGAGCAT ATAGGGAATT CAAGCTAATG AAGCTTGTTA ACCATAAAAA CATAATTGGC 
0241 TTACTTAATG CTTTTACGCC GCAAAGGAAC TTGGAAGAGT TTCAGGATGT CTACCTGGTC 
0301 ATGGAGCTGA TGGACGCTAA TCTCTGCCAG GTCATCCAAA TGGACTTGGA TCACGACAGA 
0361 ATGTCCTATT TGCTTTATCA AATGTTGTGC GGAATAAAAC ATTTACACTC AGCAGGAATT 
0421 ATTCACAGAG ACTTAAAGCC ATCCAATATA GTTGTAAAGG CCGACTGCAC TCTAAAAATT 
0481 TTGGATTTCG GTCTGGCACG  
 in silico PCR Fragment
0001 CACCAACACT ACACCGTCGA GGTGGGGGAC ACCAACTTCA CCATCCACAG TCGGTACATT 
0061 AATCTACGGC CCATAGGATC AGGTGCCCAA GGAATAGTAT GCGCCGCTTA CGATACTATC 
0121 ACCCAGCAAA ATGTGGCGAT TAAGAAACTA TCTCGACCAT TCCAAAATGT AACCCATGCC 
0181 AAGCGAGCAT ATAGGGAATT CAAGCTAATG AAGCTTGTTA ACCATAAAAA CATAATTGGC 
0241 TTACTTAATG CTTTTACGCC GCAAAGGAAC TTGGAAGAGT TTCAGGATGT CTACCTGGTC 
0301 ATGGAGCTGA TGGACGCTAA TCTCTGCCAG GTCATCCAAA TGGACTTGGA TCACGACAGA 
0361 ATGTCCTATT TGCTTTATCA AATGTTGTGC GGAATAAAAC ATTTACACTC AGCAGGAATT 
0421 ATTCACAGAG ACTTAAAGCC ATCCAATATA GTTGTAAAGG CCGACTGCAC TCTAAAAATT 
0481 TTGGATTTCG GTCTGGCACG  
 Assemble Data

5680R-1.IR_full       1   CACCAACACTACACCGTCGAGGTGGGGGACACCAACTTCACCATCCACAGTCGGTACATT 60
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
5680R-1.in silico     1   CACCAACACTACACCGTCGAGGTGGGGGACACCAACTTCACCATCCACAGTCGGTACATT 60


5680R-1.IR_full       61  AATCTACGGCCCATAGGATCAGGTGCCCAAGGAATAGTATGCGCCGCTTACGATACTATC 120
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
5680R-1.in silico     61  AATCTACGGCCCATAGGATCAGGTGCCCAAGGAATAGTATGCGCCGCTTACGATACTATC 120


5680R-1.IR_full       121 ACCCAGCAAAATGTGGCGATTAAGAAACTATCTCGACCATTCCAAAATGTAACCCATGCC 180
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
5680R-1.in silico     121 ACCCAGCAAAATGTGGCGATTAAGAAACTATCTCGACCATTCCAAAATGTAACCCATGCC 180


5680R-1.IR_full       181 AAGCGAGCATATAGGGAATTCAAGCTAATGAAGCTTGTTAACCATAAAAACATAATTGGC 240
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
5680R-1.in silico     181 AAGCGAGCATATAGGGAATTCAAGCTAATGAAGCTTGTTAACCATAAAAACATAATTGGC 240


5680R-1.IR_full       241 TTACTTAATGCTTTTACGCCGCAAAGGAACTTGGAAGAGTTTCAGGATGTCTACCTGGTC 300
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
5680R-1.in silico     241 TTACTTAATGCTTTTACGCCGCAAAGGAACTTGGAAGAGTTTCAGGATGTCTACCTGGTC 300


5680R-1.IR_full       301 ATGGAGCTGATGGACGCTAATCTCTGCCAGGTCATCCAAATGGACTTGGATCACGACAGA 360
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
5680R-1.in silico     301 ATGGAGCTGATGGACGCTAATCTCTGCCAGGTCATCCAAATGGACTTGGATCACGACAGA 360


5680R-1.IR_full       361 ATGTCCTATTTGCTTTATCAAATGTTGTGCGGAATAAAACATTTACACTCAGCAGGAATT 420
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
5680R-1.in silico     361 ATGTCCTATTTGCTTTATCAAATGTTGTGCGGAATAAAACATTTACACTCAGCAGGAATT 420


5680R-1.IR_full       421 ATTCACAGAGACTTAAAGCCATCCAATATAGTTGTAAAGGCCGACTGCACTCTAAAAATT 480
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
5680R-1.in silico     421 ATTCACAGAGACTTAAAGCCATCCAATATAGTTGTAAAGGCCGACTGCACTCTAAAAATT 480


5680R-1.IR_full       481 TTGGATTTCGGTCTGGCACG 500
                          ||||||||||||||||||||
5680R-1.in silico     481 TTGGATTTCGGTCTGGCACG 500

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_164900.1  CG5680-RB (bsk), mRNA 
0.2   NM_141972.1  CG5999-RA (CG5999), mRNA 
0   NM_057981.3  CG4063-RA (ebi), mRNA 
0   NM_170424.1  CG7609-RA, transcript variant A (CG7609), mRNA 
0   NM_143463.3  CG7609-RB, transcript variant B (CG7609), mRNA 
0   NM_141774.2  CG4596-RA (CG4596), mRNA 
0   NM_206554.1  CG33338-RA (p38c), mRNA 
0   NM_168126.1  CG5406-RB, transcript variant B (sif), mRNA 
0   NM_079572.2  CG9484-RA (hyd), mRNA 
0   NM_132805.1  CG6324-RA (CG6324), mRNA 
0   NM_001014541.1  CG8201-RM, transcript variant M (par-1), mRNA 
0   NM_143038.1  CG13636-RA, transcript variant A (CG13636), mRNA 
0   NM_206178.1  CG8201-RA, transcript variant A (par-1), mRNA 
0   NM_206173.2  CG8201-RC, transcript variant C (par-1), mRNA 
0   NM_206177.1  CG8201-RB, transcript variant B (par-1), mRNA 
0   NM_001014542.1  CG8201-RL, transcript variant L (par-1), mRNA 
0   NM_001014540.1  CG8201-RN, transcript variant N (par-1), mRNA 
0   NM_206171.2  CG8201-RH, transcript variant H (par-1), mRNA 
0   NM_206170.2  CG8201-RI, transcript variant I (par-1), mRNA 
0   NM_206169.2  CG8201-RJ, transcript variant J (par-1), mRNA 
0   NM_206168.2  CG8201-RO, transcript variant O (par-1), mRNA 
0   NM_206175.2  CG8201-RF, transcript variant F (par-1), mRNA 
0   NM_206176.2  CG8201-RD, transcript variant D (par-1), mRNA 
0   NM_206174.2  CG8201-RE, transcript variant E (par-1), mRNA 
0   NM_206172.1  CG8201-RG, transcript variant G (par-1), mRNA 
0   NM_141199.2  CG1103-RA, transcript variant A (CG1103), mRNA 
0   NM_001043195.1  CG1103-RB, transcript variant B (CG1103), mRNA 
0   NM_206278.1  CG5406-RC, transcript variant C (sif), mRNA 
0   NM_079908.2  CG5406-RA, transcript variant A (sif), mRNA 
0   NM_138258.2  CG2211-RA (CG2211), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.