National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 5576R-2 
 Symbol imd  Full Name immune deficiency 
 CG No CG5576  Old CG No CG5576 
 Synonyms CG5576, IMD, Imd, BG5, shadok, unnamed, anon-WO0172774.166, imd 
 Accession No (Link to NCBI) NM_133166.2 
 Inserted Chr. ll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees semi-lethal 
 Map Viewer
[Please submit your publication]
Wu C, Chen C, Dai J, Zhang F, Chen Y, Li W, Pastor-Pareja JC, Xue L.
Toll pathway modulates TNF-induced JNK-dependent cell death in Drosophila.
Open Biol (2015) 5(7) 140171 [ PubMed ID = 26202785 ] [ RRC reference ]

Bangi E, Pitsouli C, Rahme LG, Cagan R, Apidianakis Y.
Immune response to bacteria induces dissemination of Ras-activated Drosophila hindgut cells.
EMBO Rep. (2012) 13(6) 569-76 [ PubMed ID = 22498775 ] [ RRC reference ]  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
 Primer Seq. 3'
 Predicted Fragment Size
 IR fragment full Seq
 in silico PCR Fragment
 Assemble Data

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     1   ATCTTTGGCGGGAAGGAGGCACAGAATCCGACACCCGTCGAGGGACGCCTGGAAAAGGAC 60

                          |||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| silico     61  GCAGCTCCCGTGGACGACAACGAACCAGATAACAACAACAGCGGAGCCCTGGCGCTGCCC 120

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     121 TCCACCGCTGGCACGCCCACAGCCTCCTCGGATCTGACCGAATCCGTGCTGCGCGAGCTC 180

                          ||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| silico     181 AGCGACCCAAACTACAATTCAATGG-ATGTGGTGCATTCCGCCAATATTCCGGGCACTCT 240

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     241 CAGTAACGTCCAGACAAACAACACCATGAACGTACACAGCGCCCAGCAACAGGTGGTCAT 300

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     301 GAACTTCTCGAATGCCAATAATCTGCACTTCGGCTCCGTCTACAACTTCAACCAAAACTT 360

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     361 GAGCGCCTGCAGCTCGCGAAAGGGTAGCACCAGTACCGCAGAGGAGTCGGTCGCCTCTCC 420

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     421 AGACGGTAAGCCGCGGGCAAGTGCGACGCGCAAAACGGTCAGCATTGTGGCCATGATGCA 480

5576R-2.IR_full       481 GTCACAAGAGGAACCGGATGT 501
                          ||||||||||||||||||||| silico     481 GTCACAAGAGGAACCGGATGT 501

 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_133166.2  CG5576-RA (imd), mRNA 
0.41   NM_079387.5  CG4118-RA, transcript variant A (nxf2), mRNA 
0.41   NM_168674.2  CG4118-RB, transcript variant B (nxf2), mRNA 
0   NM_133124.1  CG7502-RA (CG7502), mRNA 
0   NM_130717.3  CG32782-RC, transcript variant C (tlk), mRNA 
0   NM_206620.4  CG32782-RD, transcript variant D (tlk), mRNA 
0   NM_137977.2  CG11299-RA (CG11299), mRNA 
0   NM_079183.2  CG1072-RA, transcript variant A (Awh), mRNA 
0   NM_168042.1  CG1072-RB, transcript variant B (Awh), mRNA 
0   NM_079449.2  CG7978-RA (Ac76E), mRNA 
0   NM_142656.2  CG17838-RB, transcript variant B (CG17838), mRNA 
0   NM_169928.1  CG17838-RC, transcript variant C (CG17838), mRNA 
0   NM_135633.2  CG4636-RA (SCAR), mRNA 
0   NM_143035.3  CG6995-RA, transcript variant A (CG6995), mRNA 
0   NM_170169.2  CG6995-RB, transcript variant B (CG6995), mRNA 
0   NM_001038977.1  CG6995-RC, transcript variant C (CG6995), mRNA 
0   NM_139554.3  CG12076-RA, transcript variant A (YT521-B), mRNA 
0   NM_168029.1  CG12076-RB, transcript variant B (YT521-B), mRNA 
0   NM_143668.2  CG1981-RA (Thd1), mRNA 
0   NM_166269.1  CG5119-RG, transcript variant G (pAbp), mRNA 
0   NM_166266.1  CG5119-RD, transcript variant D (pAbp), mRNA 
0   NM_166264.1  CG5119-RB, transcript variant B (pAbp), mRNA 
0   NM_166268.2  CG5119-RF, transcript variant F (pAbp), mRNA 
0   NM_057319.3  CG5119-RA, transcript variant A (pAbp), mRNA 
0   NM_206160.1  CG5119-RH, transcript variant H (pAbp), mRNA 
0   NM_166267.1  CG5119-RE, transcript variant E (pAbp), mRNA 
0   NM_166265.1  CG5119-RC, transcript variant C (pAbp), mRNA 
0   15  NM_142162.2  CG6912-RA (CG6912), mRNA 
0   NM_057267.3  CG9579-RA (AnnX), mRNA 
0   NM_134871.1  CG3131-RA (Duox), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.