National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 5576R-1 
 Symbol imd  Full Name immune deficiency 
 CG No CG5576  Old CG No CG5576 
 Synonyms CG5576, IMD, Imd, BG5, shadok, unnamed, anon-WO0172774.166, imd 
 Accession No (Link to NCBI) NM_133166.2 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees male puapl lethal, female pupal semi-lethal 
 Map Viewer
 Reference
[Please submit your publication]
Wu C, Chen C, Dai J, Zhang F, Chen Y, Li W, Pastor-Pareja JC, Xue L.
Toll pathway modulates TNF-induced JNK-dependent cell death in Drosophila.
Open Biol (2015) 5(7) 140171 [ PubMed ID = 26202785 ] [ RRC reference ]

Nelson B, Freisinger T, Ishii K, Okado K, Shinzawa N, Fukumoto S, Kanuka H.
Activation of Imd pathway in hemocyte confers infection resistance through humoral response in Drosophila.
Biochem. Biophys. Res. Commun. (2013) 430(3) 1120-5 [ PubMed ID = 23261474 ] [ RRC reference ]

Bangi E, Pitsouli C, Rahme LG, Cagan R, Apidianakis Y.
Immune response to bacteria induces dissemination of Ras-activated Drosophila hindgut cells.
EMBO Rep. (2012) 13(6) 569-76 [ PubMed ID = 22498775 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgATCTTTGGCGGGAAGGAGGCA 
 Primer Seq. 3'
aatctagaggtaccACATCCGGTTCCTCTTGTGAC 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 ATCTTTGGCG GGAAGGAGGC ACAGAATCCG ACACCCGTCG AGGGACGCCT GGAAAAGGAC 
0061 GCAGCTCCCG TGGACGACAA CGAACCAGAT AACAACAACA GCGGAGCCAT GGCGCTGCCC 
0121 TCCACCGCTG GCACGCCCAC AGCCTCCTCG GATCTGACCG AATCCGTGCT GCGCGAGCTC 
0181 AGCGACCCAA ACTACAATTC AATGGCATGT GGTGCATTCC GCCAATATTC CGGGCACTCT 
0241 CAGTAACGTC CAGACAAACA ACACCATGAA CGTACACAGC GCCCAGCAAC AGGTGGTCAT 
0301 GAACTTCTCG AATGCCAATA ATCTGCACTT CGGCTCCGTC TACAACTTCA ACCAAAACTT 
0361 GAGCGCCTGC AGCTCGCGAA AGGGTAGCAC CAGTACCGCA GAGGAGTCGG TCGCCTCTCC 
0421 AGACGGTAAG CCGCGGGCAA GTgCGACGCG CAAAACGGTC AGCATTGTGG CCATGATGCA 
0481 GTCACAAGAG GAACCGGATG T 
 in silico PCR Fragment
0001 ATCTTTGGCG GGAAGGAGGC ACAGAATCCG ACACCCGTCG AGGGACGCCT GGAAAAGGAC 
0061 GCAGCTCCCG TGGACGACAA CGAACCAGAT AACAACAACA GCGGAGCCCT GGCGCTGCCC 
0121 TCCACCGCTG GCACGCCCAC AGCCTCCTCG GATCTGACCG AATCCGTGCT GCGCGAGCTC 
0181 AGCGACCCAA ACTACAATTC AATGG-ATGT GGTGCATTCC GCCAATATTC CGGGCACTCT 
0241 CAGTAACGTC CAGACAAACA ACACCATGAA CGTACACAGC GCCCAGCAAC AGGTGGTCAT 
0301 GAACTTCTCG AATGCCAATA ATCTGCACTT CGGCTCCGTC TACAACTTCA ACCAAAACTT 
0361 GAGCGCCTGC AGCTCGCGAA AGGGTAGCAC CAGTACCGCA GAGGAGTCGG TCGCCTCTCC 
0421 AGACGGTAAG CCGCGGGCAA GTGCGACGCG CAAAACGGTC AGCATTGTGG CCATGATGCA 
0481 GTCACAAGAG GAACCGGATG T 
 Assemble Data

5576R-1.IR_full       1   ATCTTTGGCGGGAAGGAGGCACAGAATCCGACACCCGTCGAGGGACGCCTGGAAAAGGAC 60
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
5576R-1.in silico     1   ATCTTTGGCGGGAAGGAGGCACAGAATCCGACACCCGTCGAGGGACGCCTGGAAAAGGAC 60


5576R-1.IR_full       61  GCAGCTCCCGTGGACGACAACGAACCAGATAACAACAACAGCGGAGCCATGGCGCTGCCC 120
                          |||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||
5576R-1.in silico     61  GCAGCTCCCGTGGACGACAACGAACCAGATAACAACAACAGCGGAGCCCTGGCGCTGCCC 120


5576R-1.IR_full       121 TCCACCGCTGGCACGCCCACAGCCTCCTCGGATCTGACCGAATCCGTGCTGCGCGAGCTC 180
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
5576R-1.in silico     121 TCCACCGCTGGCACGCCCACAGCCTCCTCGGATCTGACCGAATCCGTGCTGCGCGAGCTC 180


5576R-1.IR_full       181 AGCGACCCAAACTACAATTCAATGGCATGTGGTGCATTCCGCCAATATTCCGGGCACTCT 240
                          ||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||
5576R-1.in silico     181 AGCGACCCAAACTACAATTCAATGG-ATGTGGTGCATTCCGCCAATATTCCGGGCACTCT 240


5576R-1.IR_full       241 CAGTAACGTCCAGACAAACAACACCATGAACGTACACAGCGCCCAGCAACAGGTGGTCAT 300
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
5576R-1.in silico     241 CAGTAACGTCCAGACAAACAACACCATGAACGTACACAGCGCCCAGCAACAGGTGGTCAT 300


5576R-1.IR_full       301 GAACTTCTCGAATGCCAATAATCTGCACTTCGGCTCCGTCTACAACTTCAACCAAAACTT 360
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
5576R-1.in silico     301 GAACTTCTCGAATGCCAATAATCTGCACTTCGGCTCCGTCTACAACTTCAACCAAAACTT 360


5576R-1.IR_full       361 GAGCGCCTGCAGCTCGCGAAAGGGTAGCACCAGTACCGCAGAGGAGTCGGTCGCCTCTCC 420
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
5576R-1.in silico     361 GAGCGCCTGCAGCTCGCGAAAGGGTAGCACCAGTACCGCAGAGGAGTCGGTCGCCTCTCC 420


5576R-1.IR_full       421 AGACGGTAAGCCGCGGGCAAGTGCGACGCGCAAAACGGTCAGCATTGTGGCCATGATGCA 480
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
5576R-1.in silico     421 AGACGGTAAGCCGCGGGCAAGTGCGACGCGCAAAACGGTCAGCATTGTGGCCATGATGCA 480


5576R-1.IR_full       481 GTCACAAGAGGAACCGGATGT 501
                          |||||||||||||||||||||
5576R-1.in silico     481 GTCACAAGAGGAACCGGATGT 501

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_133166.2  CG5576-RA (imd), mRNA 
0.41   NM_079387.5  CG4118-RA, transcript variant A (nxf2), mRNA 
0.41   NM_168674.2  CG4118-RB, transcript variant B (nxf2), mRNA 
0   NM_133124.1  CG7502-RA (CG7502), mRNA 
0   NM_130717.3  CG32782-RC, transcript variant C (tlk), mRNA 
0   NM_206620.4  CG32782-RD, transcript variant D (tlk), mRNA 
0   NM_137977.2  CG11299-RA (CG11299), mRNA 
0   NM_079183.2  CG1072-RA, transcript variant A (Awh), mRNA 
0   NM_168042.1  CG1072-RB, transcript variant B (Awh), mRNA 
0   NM_079449.2  CG7978-RA (Ac76E), mRNA 
0   NM_142656.2  CG17838-RB, transcript variant B (CG17838), mRNA 
0   NM_169928.1  CG17838-RC, transcript variant C (CG17838), mRNA 
0   NM_135633.2  CG4636-RA (SCAR), mRNA 
0   NM_143035.3  CG6995-RA, transcript variant A (CG6995), mRNA 
0   NM_170169.2  CG6995-RB, transcript variant B (CG6995), mRNA 
0   NM_001038977.1  CG6995-RC, transcript variant C (CG6995), mRNA 
0   NM_139554.3  CG12076-RA, transcript variant A (YT521-B), mRNA 
0   NM_168029.1  CG12076-RB, transcript variant B (YT521-B), mRNA 
0   NM_143668.2  CG1981-RA (Thd1), mRNA 
0   NM_166269.1  CG5119-RG, transcript variant G (pAbp), mRNA 
0   NM_166266.1  CG5119-RD, transcript variant D (pAbp), mRNA 
0   NM_166264.1  CG5119-RB, transcript variant B (pAbp), mRNA 
0   NM_166268.2  CG5119-RF, transcript variant F (pAbp), mRNA 
0   NM_057319.3  CG5119-RA, transcript variant A (pAbp), mRNA 
0   NM_206160.1  CG5119-RH, transcript variant H (pAbp), mRNA 
0   NM_166267.1  CG5119-RE, transcript variant E (pAbp), mRNA 
0   NM_166265.1  CG5119-RC, transcript variant C (pAbp), mRNA 
0   15  NM_142162.2  CG6912-RA (CG6912), mRNA 
0   NM_057267.3  CG9579-RA (AnnX), mRNA 
0   NM_134871.1  CG3131-RA (Duox), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.