National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
Notification of resumption of orders:

Orders have been suspended as a response to the COVID-19 infection, but it will be resumed today, May 11. However, we would like to set our organizational framework that prioritizes the maintenance of stocks for the time being. In addition, due to delays in delivery of postal items, it is expected that the flies you ordered will not reach you in normal period. We apologize for the inconvenience.

Thank you for your understanding.

NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 5562R-3 
 Symbol gbb  Full Name glass bottom boat 
 CG No CG5562  Old CG No CG5562 
 Synonyms Gbb, gbb-60A, Dm-GBB, TGF-b, tgfb-60A, 60A, gcn, l(2)60A-J, Gbb-60A, TGFbeta-60A, Tgfbeta-60A, Tgfb-60, SixtyA, vgr/60A, CG5562, gbb, GBB, BMP 
 Accession No (Link to NCBI) NM_057992.2 
 Inserted Chr. ll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
[Please submit your publication]
Wang M, Chen PY, Wang CH, Lai TT, Tsai PI, Cheng YJ, Kao HH, Chien CT.
Dbo/Henji Modulates Synaptic dPAK to Gate Glutamate Receptor Abundance and Postsynaptic Response.
PLoS Genet. (2016) 12(10) e1006362 [ PubMed ID = 27736876 ] [ RRC reference ]

Chang YC, Tu H, Chen JY, Chang CC, Yang SY, Pi H.
Reproduction disrupts stem cell homeostasis in testes of aged male Drosophila via an induced microenvironment.
PLoS Genet. (2019) 15(7) e1008062 [ PubMed ID = 31295251 ] [ RRC reference ]

Sato T, Ogata J, Niki Y.
BMP and Hh signaling affects primordial germ cell division in Drosophila.
Zool. Sci. (2010) 27(10) 804-10 [ PubMed ID = 20887178 ] [ RRC reference ]

Ito S, Ueda T, Ueno A, Nakagawa H, Taniguchi H, Kayukawa N, Miki T.
A genetic screen in Drosophila for regulators of human prostate cancer progression.
Biochem. Biophys. Res. Commun. (2014) 451(4) 548-55 [ PubMed ID = 25117438 ] [ RRC reference ]

Lesch C, Jo J, Wu Y, Fish GS, Galko MJ.
A targeted UAS-RNAi screen in Drosophila larvae identifies wound closure genes regulating distinct cellular processes.
Genetics (2010) 186(3) 943-57 [ PubMed ID = 20813879 ] [ RRC reference ]

Cho Y, Lai CM, Lin KY, Hsu HJ.
A Targeted RNAi Screen Reveals Drosophila Female-Sterile Genes That Control the Size of Germline Stem Cell Niche During Development.
G3 (Bethesda) (2018) 8(7) 2345-2354 [ PubMed ID = 29764959 ] [ RRC reference ]

Umemori M, Habara O, Iwata T, Maeda K, Nishinoue K, Okabe A, Takemura M, Takahashi K, Saigo K, Ueda R, Adachi-Yamada T.
RNAi-mediated knockdown showing impaired cell survival in Drosophila wing imaginal disc.
Gene Regul Syst Bio (2009) 3 11-20 [ PubMed ID = 19838331 ] [ RRC reference ]

Tiwari P, Kumar A, Das RN, Malhotra V, VijayRaghavan K.
A Tendon Cell Specific RNAi Screen Reveals Novel Candidates Essential for Muscle Tendon Interaction.
PLoS ONE (2015) 10(10) e0140976 [ PubMed ID = 26488612 ] [ RRC reference ]  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
 Primer Seq. 3'
 Predicted Fragment Size
 IR fragment full Seq
 in silico PCR Fragment
 Assemble Data

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     1   AGTGCTGAGCGAGGACGACAAGCTGGACGTCTCGTACGAGATCCTCGAGTTCCTGGGCAT 60

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     61  CGCCGAACGGCCGACGCACCTGAGCAGCCACCAGTTGTCGCTGAGGAAGTCGGCTCCCAA 120

                          |||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| silico     121 GTTCCTGCTGGACGTCTA-CCACCGCATCACGGCGGAGGAGGGTCTCAGCGATCAGGATG 180

                          ||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| silico     181 AGGACGACGACTACGAACGCGGCCATCGGTCCAGGAGGAGCGCCGACCTCGAGGAGGATG 240

                          ||| |||||||||||||||||||||||||||||| ||||||||||||||||||||||||| silico     241 AGGGCGAGCAGCAGAAGAACTTCATCACCGACCTGGACAAGCGGGCCATCGACGAGAGCG 300

                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || silico     301 ACATCATCATGACCTTCCTGAACAAGCGCCACCACAATGTGGACGAACTGCGTCACG-AG 360

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| silico     361 CACGGCCGTCGCCTGTGGTTCGACGTCTCCAACGTGCCCAACGACAACTACCTGGTGATG 420

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     421 GCCGAGCTGCGCATCTATCAGAACGCCAACGAGGGCAAGTGGCTGACCGCCAACAGGGAG 480

5562R-3.IR_full       481 TTCACCATCACGGTATACGCCA 502
                          |||||||||||||||||||||| silico     481 TTCACCATCACGGTATACGCCA 502

 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_057992.2  CG5562-RA (gbb), mRNA 
0.82   NM_169261.1  CG9745-RB, transcript variant B (D1), mRNA 
0.82   NM_079562.1  CG9745-RA, transcript variant A (D1), mRNA 
0.82   NM_169262.1  CG9745-RC, transcript variant C (D1), mRNA 
0.62   NM_167348.1  CG32638-RA (CG32638), mRNA 
0   16  NM_079712.2  CG18402-RA (InR), mRNA 
0   NM_135487.2  CG4709-RA (CG4709), mRNA 
0   NM_135032.1  CG12787-RC, transcript variant C (hoe1), mRNA 
0   NM_175967.1  CG12787-RE, transcript variant E (hoe1), mRNA 
0   NM_175966.1  CG12787-RD, transcript variant D (hoe1), mRNA 
0   NM_175968.1  CG12787-RF, transcript variant F (hoe1), mRNA 
0   NM_164603.1  CG12787-RB, transcript variant B (hoe1), mRNA 
0   NM_135031.3  CG12787-RA, transcript variant A (hoe1), mRNA 
0   NM_169487.1  CG31342-RA (CG31342), mRNA 
0   NM_206242.1  CG32306-RD, transcript variant D (CG32306), mRNA 
0   NM_139464.2  CG32306-RB, transcript variant B (CG32306), mRNA 
0   NM_141261.2  CG1115-RA (CG1115), mRNA 
0   10  NM_134690.2  CG2807-RA (CG2807), mRNA 
0   NM_078664.2  CG5870-RA (beta-Spec), mRNA 
0   11  NM_169423.2  CG17342-RB, transcript variant B (Lk6), mRNA 
0   11  NM_143729.2  CG17342-RA, transcript variant A (Lk6), mRNA 
0   NM_167216.1  CG15312-RC, transcript variant C (CG15312), mRNA 
0   NM_167215.1  CG15312-RB, transcript variant B (CG15312), mRNA 
0   NM_130629.2  CG3457-RA (CG3457), mRNA 
0   NM_132373.2  CG15312-RA, transcript variant A (CG15312), mRNA 
0   NM_078643.2  CG4211-RA, transcript variant A (nonA), mRNA 
0   NM_001014747.1  CG4211-RC, transcript variant C (nonA), mRNA 
0   NM_167505.1  CG4211-RB, transcript variant B (nonA), mRNA 
0   12  NM_058149.3  CG3352-RA (ft), mRNA 
0   NM_139655.1  CG13721-RA (CG13721), mRNA 
 Wing Disc
JNK signal
Caspase-3 signal
Dcompartment   Penetrance

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.