National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 5562R-1 
 Symbol gbb  Full Name glass bottom boat 
 CG No CG5562  Old CG No CG5562 
 Synonyms Gbb, gbb-60A, Dm-GBB, TGF-b, tgfb-60A, 60A, gcn, l(2)60A-J, Gbb-60A, TGFbeta-60A, Tgfbeta-60A, Tgfb-60, SixtyA, vgr/60A, CG5562, gbb, GBB, BMP 
 Accession No (Link to NCBI) NM_057992.2 
 Inserted Chr. ll 
 Insertional Mutation  lethal 
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
[Please submit your publication]
Wang M, Chen PY, Wang CH, Lai TT, Tsai PI, Cheng YJ, Kao HH, Chien CT.
Dbo/Henji Modulates Synaptic dPAK to Gate Glutamate Receptor Abundance and Postsynaptic Response.
PLoS Genet (2016) 12(10) e1006362 [ PubMed ID = 27736876 ] [ RRC reference ]

Yamanaka N, Marqués G, O'Connor MB.
Vesicle-Mediated Steroid Hormone Secretion in Drosophila melanogaster.
Cell (2015) 163(4) 907-19 [ PubMed ID = 26544939 ] [ RRC reference ]

Sato T, Ogata J, Niki Y.
BMP and Hh signaling affects primordial germ cell division in Drosophila.
Zoolog Sci (2010) 27(10) 804-10 [ PubMed ID = 20887178 ] [ RRC reference ]

Cho Y, Lai CM, Lin KY, Hsu HJ.
A Targeted RNAi Screen Reveals Drosophila Female-Sterile Genes That Control the Size of Germline Stem Cell Niche During Development.
G3 (Bethesda) (2018) 8(7) 2345-2354 [ PubMed ID = 29764959 ] [ RRC reference ]

Tiwari P, Kumar A, Das RN, Malhotra V, VijayRaghavan K.
A Tendon Cell Specific RNAi Screen Reveals Novel Candidates Essential for Muscle Tendon Interaction.
PLoS One (2015) 10(10) e0140976 [ PubMed ID = 26488612 ] [ RRC reference ]

Lesch C, Jo J, Wu Y, Fish GS, Galko MJ.
A targeted UAS-RNAi screen in Drosophila larvae identifies wound closure genes regulating distinct cellular processes.
Genetics (2010) 186(3) 943-57 [ PubMed ID = 20813879 ] [ RRC reference ]  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
 Primer Seq. 3'
 Predicted Fragment Size
 IR fragment full Seq
 in silico PCR Fragment
 Assemble Data

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     1   AGTGCTGAGCGAGGACGACAAGCTGGACGTCTCGTACGAGATCCTCGAGTTCCTGGGCAT 60

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     61  CGCCGAACGGCCGACGCACCTGAGCAGCCACCAGTTGTCGCTGAGGAAGTCGGCTCCCAA 120

                          |||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| silico     121 GTTCCTGCTGGACGTCTA-CCACCGCATCACGGCGGAGGAGGGTCTCAGCGATCAGGATG 180

                          ||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| silico     181 AGGACGACGACTACGAACGCGGCCATCGGTCCAGGAGGAGCGCCGACCTCGAGGAGGATG 240

                          ||| |||||||||||||||||||||||||||||| ||||||||||||||||||||||||| silico     241 AGGGCGAGCAGCAGAAGAACTTCATCACCGACCTGGACAAGCGGGCCATCGACGAGAGCG 300

                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || silico     301 ACATCATCATGACCTTCCTGAACAAGCGCCACCACAATGTGGACGAACTGCGTCACG-AG 360

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| silico     361 CACGGCCGTCGCCTGTGGTTCGACGTCTCCAACGTGCCCAACGACAACTACCTGGTGATG 420

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     421 GCCGAGCTGCGCATCTATCAGAACGCCAACGAGGGCAAGTGGCTGACCGCCAACAGGGAG 480

5562R-1.IR_full       481 TTCACCATCACGGTATACGCCA 502
                          |||||||||||||||||||||| silico     481 TTCACCATCACGGTATACGCCA 502

 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_057992.2  CG5562-RA (gbb), mRNA 
0.82   NM_169261.1  CG9745-RB, transcript variant B (D1), mRNA 
0.82   NM_079562.1  CG9745-RA, transcript variant A (D1), mRNA 
0.82   NM_169262.1  CG9745-RC, transcript variant C (D1), mRNA 
0.62   NM_167348.1  CG32638-RA (CG32638), mRNA 
0   16  NM_079712.2  CG18402-RA (InR), mRNA 
0   NM_135487.2  CG4709-RA (CG4709), mRNA 
0   NM_135032.1  CG12787-RC, transcript variant C (hoe1), mRNA 
0   NM_175967.1  CG12787-RE, transcript variant E (hoe1), mRNA 
0   NM_175966.1  CG12787-RD, transcript variant D (hoe1), mRNA 
0   NM_175968.1  CG12787-RF, transcript variant F (hoe1), mRNA 
0   NM_164603.1  CG12787-RB, transcript variant B (hoe1), mRNA 
0   NM_135031.3  CG12787-RA, transcript variant A (hoe1), mRNA 
0   NM_169487.1  CG31342-RA (CG31342), mRNA 
0   NM_206242.1  CG32306-RD, transcript variant D (CG32306), mRNA 
0   NM_139464.2  CG32306-RB, transcript variant B (CG32306), mRNA 
0   NM_141261.2  CG1115-RA (CG1115), mRNA 
0   10  NM_134690.2  CG2807-RA (CG2807), mRNA 
0   NM_078664.2  CG5870-RA (beta-Spec), mRNA 
0   11  NM_169423.2  CG17342-RB, transcript variant B (Lk6), mRNA 
0   11  NM_143729.2  CG17342-RA, transcript variant A (Lk6), mRNA 
0   NM_167216.1  CG15312-RC, transcript variant C (CG15312), mRNA 
0   NM_167215.1  CG15312-RB, transcript variant B (CG15312), mRNA 
0   NM_130629.2  CG3457-RA (CG3457), mRNA 
0   NM_132373.2  CG15312-RA, transcript variant A (CG15312), mRNA 
0   NM_078643.2  CG4211-RA, transcript variant A (nonA), mRNA 
0   NM_001014747.1  CG4211-RC, transcript variant C (nonA), mRNA 
0   NM_167505.1  CG4211-RB, transcript variant B (nonA), mRNA 
0   12  NM_058149.3  CG3352-RA (ft), mRNA 
0   NM_139655.1  CG13721-RA (CG13721), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.