National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 5562R-1 
 Symbol gbb  Full Name glass bottom boat 
 CG No CG5562  Old CG No CG5562 
 Synonyms Gbb, gbb-60A, Dm-GBB, TGF-b, tgfb-60A, 60A, gcn, l(2)60A-J, Gbb-60A, TGFbeta-60A, Tgfbeta-60A, Tgfb-60, SixtyA, vgr/60A, CG5562, gbb, GBB, BMP 
 Accession No (Link to NCBI) NM_057992.2 
 Inserted Chr. ll 
 Insertional Mutation  lethal 
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
 Reference
[Please submit your publication]
Wang M, Chen PY, Wang CH, Lai TT, Tsai PI, Cheng YJ, Kao HH, Chien CT.
Dbo/Henji Modulates Synaptic dPAK to Gate Glutamate Receptor Abundance and Postsynaptic Response.
PLoS Genet. (2016) 12(10) e1006362 [ PubMed ID = 27736876 ] [ RRC reference ]

Yamanaka N, Marqués G, O'Connor MB.
Vesicle-Mediated Steroid Hormone Secretion in Drosophila melanogaster.
Cell (2015) 163(4) 907-19 [ PubMed ID = 26544939 ] [ RRC reference ]

Tiwari P, Kumar A, Das RN, Malhotra V, VijayRaghavan K.
A Tendon Cell Specific RNAi Screen Reveals Novel Candidates Essential for Muscle Tendon Interaction.
PLoS ONE (2015) 10(10) e0140976 [ PubMed ID = 26488612 ] [ RRC reference ]

Lesch C, Jo J, Wu Y, Fish GS, Galko MJ.
A targeted UAS-RNAi screen in Drosophila larvae identifies wound closure genes regulating distinct cellular processes.
Genetics (2010) 186(3) 943-57 [ PubMed ID = 20813879 ] [ RRC reference ]

Sato T, Ogata J, Niki Y.
BMP and Hh signaling affects primordial germ cell division in Drosophila.
Zoolog Sci. (2010) 27(10) 804-10 [ PubMed ID = 20887178 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgAGTGCTGAGCGAGGACGACAA 
 Primer Seq. 3'
aatctagaggtaccTGGCGTATACCGTGATGGTGA 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 AGTGCTGAGC GAGGACGACA AGCTGGACGT CTCGTACGAG ATCCTCGAGT TCCTGGGCAT 
0061 CGcCGAACGG CCGACGCACC TGAGCAGCCA CCAGTTGTCG CTGAGGAAGT CGGCTCCCAA 
0121 GTTCCTGCTG GACGTCTANC CACCGCATCA CGGCGGAGGA GGGTCTCAGC GATCAGGATG 
0181 AGGACGACGC CTACGAACGC GGCCATCGGT CCAGGAGGAG CGCCGACCTC GAGGAGGATG 
0241 AGGCCGAGCA GCAGAAGAAC TTCATCACCG ACCTAGACAA GCGGGCCATC GACGAGAGCG 
0301 ACATCATCAT GACCTTCCTG AACAAGCGCC ACCACAATGT GGACGAACTG CGTCACGNAG 
0361 CACGGCCGTC GCCTGTGGTT CGACGTCTCC AACGTGCCCA ACGACAACTA CCTGGTTATG 
0421 GCCGAGCTGC GCATCTATCA GAACGCCAAC GAGGGCAAGT GGCTGACCGC CAACAGGGAG 
0481 TTCACCATCA CGGTATACGC CA 
 in silico PCR Fragment
0001 AGTGCTGAGC GAGGACGACA AGCTGGACGT CTCGTACGAG ATCCTCGAGT TCCTGGGCAT 
0061 CGCCGAACGG CCGACGCACC TGAGCAGCCA CCAGTTGTCG CTGAGGAAGT CGGCTCCCAA 
0121 GTTCCTGCTG GACGTCTA-C CACCGCATCA CGGCGGAGGA GGGTCTCAGC GATCAGGATG 
0181 AGGACGACGA CTACGAACGC GGCCATCGGT CCAGGAGGAG CGCCGACCTC GAGGAGGATG 
0241 AGGGCGAGCA GCAGAAGAAC TTCATCACCG ACCTGGACAA GCGGGCCATC GACGAGAGCG 
0301 ACATCATCAT GACCTTCCTG AACAAGCGCC ACCACAATGT GGACGAACTG CGTCACG-AG 
0361 CACGGCCGTC GCCTGTGGTT CGACGTCTCC AACGTGCCCA ACGACAACTA CCTGGTGATG 
0421 GCCGAGCTGC GCATCTATCA GAACGCCAAC GAGGGCAAGT GGCTGACCGC CAACAGGGAG 
0481 TTCACCATCA CGGTATACGC CA 
 Assemble Data

5562R-1.IR_full       1   AGTGCTGAGCGAGGACGACAAGCTGGACGTCTCGTACGAGATCCTCGAGTTCCTGGGCAT 60
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
5562R-1.in silico     1   AGTGCTGAGCGAGGACGACAAGCTGGACGTCTCGTACGAGATCCTCGAGTTCCTGGGCAT 60


5562R-1.IR_full       61  CGCCGAACGGCCGACGCACCTGAGCAGCCACCAGTTGTCGCTGAGGAAGTCGGCTCCCAA 120
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
5562R-1.in silico     61  CGCCGAACGGCCGACGCACCTGAGCAGCCACCAGTTGTCGCTGAGGAAGTCGGCTCCCAA 120


5562R-1.IR_full       121 GTTCCTGCTGGACGTCTANCCACCGCATCACGGCGGAGGAGGGTCTCAGCGATCAGGATG 180
                          |||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||
5562R-1.in silico     121 GTTCCTGCTGGACGTCTA-CCACCGCATCACGGCGGAGGAGGGTCTCAGCGATCAGGATG 180


5562R-1.IR_full       181 AGGACGACGCCTACGAACGCGGCCATCGGTCCAGGAGGAGCGCCGACCTCGAGGAGGATG 240
                          ||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||
5562R-1.in silico     181 AGGACGACGACTACGAACGCGGCCATCGGTCCAGGAGGAGCGCCGACCTCGAGGAGGATG 240


5562R-1.IR_full       241 AGGCCGAGCAGCAGAAGAACTTCATCACCGACCTAGACAAGCGGGCCATCGACGAGAGCG 300
                          ||| |||||||||||||||||||||||||||||| |||||||||||||||||||||||||
5562R-1.in silico     241 AGGGCGAGCAGCAGAAGAACTTCATCACCGACCTGGACAAGCGGGCCATCGACGAGAGCG 300


5562R-1.IR_full       301 ACATCATCATGACCTTCCTGAACAAGCGCCACCACAATGTGGACGAACTGCGTCACGNAG 360
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||
5562R-1.in silico     301 ACATCATCATGACCTTCCTGAACAAGCGCCACCACAATGTGGACGAACTGCGTCACG-AG 360


5562R-1.IR_full       361 CACGGCCGTCGCCTGTGGTTCGACGTCTCCAACGTGCCCAACGACAACTACCTGGTTATG 420
                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||
5562R-1.in silico     361 CACGGCCGTCGCCTGTGGTTCGACGTCTCCAACGTGCCCAACGACAACTACCTGGTGATG 420


5562R-1.IR_full       421 GCCGAGCTGCGCATCTATCAGAACGCCAACGAGGGCAAGTGGCTGACCGCCAACAGGGAG 480
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
5562R-1.in silico     421 GCCGAGCTGCGCATCTATCAGAACGCCAACGAGGGCAAGTGGCTGACCGCCAACAGGGAG 480


5562R-1.IR_full       481 TTCACCATCACGGTATACGCCA 502
                          ||||||||||||||||||||||
5562R-1.in silico     481 TTCACCATCACGGTATACGCCA 502

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_057992.2  CG5562-RA (gbb), mRNA 
0.82   NM_169261.1  CG9745-RB, transcript variant B (D1), mRNA 
0.82   NM_079562.1  CG9745-RA, transcript variant A (D1), mRNA 
0.82   NM_169262.1  CG9745-RC, transcript variant C (D1), mRNA 
0.62   NM_167348.1  CG32638-RA (CG32638), mRNA 
0   16  NM_079712.2  CG18402-RA (InR), mRNA 
0   NM_135487.2  CG4709-RA (CG4709), mRNA 
0   NM_135032.1  CG12787-RC, transcript variant C (hoe1), mRNA 
0   NM_175967.1  CG12787-RE, transcript variant E (hoe1), mRNA 
0   NM_175966.1  CG12787-RD, transcript variant D (hoe1), mRNA 
0   NM_175968.1  CG12787-RF, transcript variant F (hoe1), mRNA 
0   NM_164603.1  CG12787-RB, transcript variant B (hoe1), mRNA 
0   NM_135031.3  CG12787-RA, transcript variant A (hoe1), mRNA 
0   NM_169487.1  CG31342-RA (CG31342), mRNA 
0   NM_206242.1  CG32306-RD, transcript variant D (CG32306), mRNA 
0   NM_139464.2  CG32306-RB, transcript variant B (CG32306), mRNA 
0   NM_141261.2  CG1115-RA (CG1115), mRNA 
0   10  NM_134690.2  CG2807-RA (CG2807), mRNA 
0   NM_078664.2  CG5870-RA (beta-Spec), mRNA 
0   11  NM_169423.2  CG17342-RB, transcript variant B (Lk6), mRNA 
0   11  NM_143729.2  CG17342-RA, transcript variant A (Lk6), mRNA 
0   NM_167216.1  CG15312-RC, transcript variant C (CG15312), mRNA 
0   NM_167215.1  CG15312-RB, transcript variant B (CG15312), mRNA 
0   NM_130629.2  CG3457-RA (CG3457), mRNA 
0   NM_132373.2  CG15312-RA, transcript variant A (CG15312), mRNA 
0   NM_078643.2  CG4211-RA, transcript variant A (nonA), mRNA 
0   NM_001014747.1  CG4211-RC, transcript variant C (nonA), mRNA 
0   NM_167505.1  CG4211-RB, transcript variant B (nonA), mRNA 
0   12  NM_058149.3  CG3352-RA (ft), mRNA 
0   NM_139655.1  CG13721-RA (CG13721), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.