National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 5546R-1 
 Symbol MED19  Full Name Mediator complex subunit 19 
 CG No CG5546  Old CG No CG5546 
 Synonyms CG5546, MED19 
 Accession No (Link to NCBI) NM_140759.2 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
 Reference
[Please submit your publication]
Terriente-Félix A, López-Varea A, de Celis JF.
Identification of genes affecting wing patterning through a loss-of-function mutagenesis screen and characterization of med15 function during wing development.
Genetics (2010) 185(2) 671-84 [ PubMed ID = 20233856 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgCCGCTGCCGGAACAGTATCGT 
 Primer Seq. 3'
aatctagaggtaccCTAGTGCCCAGCACAGATCCC 
 Predicted Fragment Size
497 
 IR fragment full Seq
0001 CCGCTGCCGG AACAGTATCG TACCACATAT GTCACACCTG CGCGTAAACA CAAAAACAAA 
0061 CACAAAAAGC AAAAACACAA AGACGGGGTG ACCACGGGAC AGGAATCCAC GCTGCTCGAC 
0121 TCGGCCGGCC TGGAGACTTA CGAGAAAAAG CACAAGAAGC AGAAACGCCA TGAGGACGAC 
0181 AAGGAGCGCA AGAAGCGCAA AAAGGAGAAA AAGCGTAAAA AGAAAAACCA GAGCCCCGAA 
0241 CCGGGCGTGG GCTTGCTGCC CGGAGGAGCG AGCTTGGGCG GAGCAGCNGG GTGTAATGGG 
0301 AGCCACTAGT CTGGGATCGN CTGGGAGGAG GACCTGGAGG ACCCGGGNCT GTCCAGCCTT 
0361 AGTGCCAGTA TGGGACCTGG CGTTGTGGGG AACATGAATA GCTTCTCTCT CATCGATGCA 
0421 GATGCAGCAG CAACAGCAGT ATGCCCTATG CAGCAACAGC AGATGTCAAG TGGCGGCTCT 
0481 GCTGGGATCT GTGCTGGGCA CTAG 
 in silico PCR Fragment
0001 CCGCTGCCGG AACAGTATCG TACCACATAT GTCACACCTG CGCGTAAACA CAAAAACAAA 
0061 CACAAAAAGC AAAAACACAA AGACGGGGTG ACCACGGGAC AGGAATCCAC GCTGCTCGAC 
0121 TCGGCCGGCC TGGAGACTTA CGAGAAAAAG CACAAGAAGC AGAAACGCCA TGAGGACGAC 
0181 AAGGAGCGCA AGAAGCGCAA AAAGGAGAAA AAGCGTAAAA AGAAAAACCA GAGCCCCGAA 
0241 CCGGGCGTGG GCTTGCTGCC CGGAGGAGCG AGCTTGGGCG GAGCAGC-GG GTGTAATGGG 
0301 AGCCACTAGT CTGGGATCG- CTGGGAGGAG GACCTGGAGG ACCCGGG-CT GTCCAGCCTT 
0361 AGTGCCAGTA TGGGACCTGG CGTTGTGGGG AACATGAATA GCTTCTC-CT CATCGATGCA 
0421 GATGCAGCAG CAACAGCAG- ATGCCC-ATG CAGCAACAGC AGATGTCAAG TGGCGG-TCT 
0481 GCTGGGATCT GTGCTGGGCA CTAG 
 Assemble Data

5546R-1.IR_full       1   CCGCTGCCGGAACAGTATCGTACCACATATGTCACACCTGCGCGTAAACACAAAAACAAA 60
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
5546R-1.in silico     1   CCGCTGCCGGAACAGTATCGTACCACATATGTCACACCTGCGCGTAAACACAAAAACAAA 60


5546R-1.IR_full       61  CACAAAAAGCAAAAACACAAAGACGGGGTGACCACGGGACAGGAATCCACGCTGCTCGAC 120
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
5546R-1.in silico     61  CACAAAAAGCAAAAACACAAAGACGGGGTGACCACGGGACAGGAATCCACGCTGCTCGAC 120


5546R-1.IR_full       121 TCGGCCGGCCTGGAGACTTACGAGAAAAAGCACAAGAAGCAGAAACGCCATGAGGACGAC 180
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
5546R-1.in silico     121 TCGGCCGGCCTGGAGACTTACGAGAAAAAGCACAAGAAGCAGAAACGCCATGAGGACGAC 180


5546R-1.IR_full       181 AAGGAGCGCAAGAAGCGCAAAAAGGAGAAAAAGCGTAAAAAGAAAAACCAGAGCCCCGAA 240
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
5546R-1.in silico     181 AAGGAGCGCAAGAAGCGCAAAAAGGAGAAAAAGCGTAAAAAGAAAAACCAGAGCCCCGAA 240


5546R-1.IR_full       241 CCGGGCGTGGGCTTGCTGCCCGGAGGAGCGAGCTTGGGCGGAGCAGCNGGGTGTAATGGG 300
                          ||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||
5546R-1.in silico     241 CCGGGCGTGGGCTTGCTGCCCGGAGGAGCGAGCTTGGGCGGAGCAGC-GGGTGTAATGGG 300


5546R-1.IR_full       301 AGCCACTAGTCTGGGATCGNCTGGGAGGAGGACCTGGAGGACCCGGGNCTGTCCAGCCTT 360
                          ||||||||||||||||||| ||||||||||||||||||||||||||| ||||||||||||
5546R-1.in silico     301 AGCCACTAGTCTGGGATCG-CTGGGAGGAGGACCTGGAGGACCCGGG-CTGTCCAGCCTT 360


5546R-1.IR_full       361 AGTGCCAGTATGGGACCTGGCGTTGTGGGGAACATGAATAGCTTCTCTCTCATCGATGCA 420
                          ||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||
5546R-1.in silico     361 AGTGCCAGTATGGGACCTGGCGTTGTGGGGAACATGAATAGCTTCTC-CTCATCGATGCA 420


5546R-1.IR_full       421 GATGCAGCAGCAACAGCAGTATGCCCTATGCAGCAACAGCAGATGTCAAGTGGCGGCTCT 480
                          ||||||||||||||||||| |||||| ||||||||||||||||||||||||||||| |||
5546R-1.in silico     421 GATGCAGCAGCAACAGCAG-ATGCCC-ATGCAGCAACAGCAGATGTCAAGTGGCGG-TCT 480


5546R-1.IR_full       481 GCTGGGATCTGTGCTGGGCACTAG 504
                          ||||||||||||||||||||||||
5546R-1.in silico     481 GCTGGGATCTGTGCTGGGCACTAG 504

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.