National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 5520R-3 
 Symbol Gp93  Full Name Glycoprotein 93 
 CG No CG5520  Old CG No CG5520 
 Synonyms CT17486, gp93, CG5520, p93, Gp93 
 Accession No (Link to NCBI) NM_143344.2 
 Inserted Chr. ll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
 Reference
[Please submit your publication]
Maynard JC, Pham T, Zheng T, Jockheck-Clark A, Rankin HB, Newgard CB, Spana EP, Nicchitta CV.
Gp93, the Drosophila GRP94 ortholog, is required for gut epithelial homeostasis and nutrient assimilation-coupled growth control.
Dev. Biol. (2010) 339(2) 295-306 [ PubMed ID = 20044986 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgCTGCTCCTAGCAGGCATCAAT 
 Primer Seq. 3'
aatctagaggtaccTTGGCCAGAAAATCGGCAGTG 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 CTGCTCCTAG CAGGCATCAA TCAAATAGCC GCCGATGACG AGGCCGCCAC AACGGAGACC 
0061 ATCGACCTTG ATCTGGGCTC CTTCAAGGAG GGCTCCCGCA CCGATGCCGA GACCCTGAAG 
0121 CGCGAGGAGG AGGCCATCCA GCTGGACGGC CTGAACGTGG CGCAGCTGAA GGAAATTCGC 
0181 GAGAAGGCGA AGAAGTTTAC TTTCCAAACG GAGGTCAACC GCATGATGAA GCTGATTATC 
0241 AACTCGCTTT ACCGCAACAA GGAGATCTTC CTGCGTGAAT TGATATCCAA CGCCTCCGAT 
0301 GCCATCGACA AGATCCGCCT ATTGGCTCTG TCCAACAGCA AGGAGCTGGA AACGAATCCG 
0361 GAGCTGCACA TCCGCATTAA GGCCGACAAG GAGAACAAGG CGTTGCACAT CATGGACTCG 
0421 GGGTATCGGC ATGACTCACC AGGATCTGAT CAATAACCTG GGTACAATTG CCAAGTCCGG 
0481 CACTGCCGAT TTTTCTGGCC AA 
 in silico PCR Fragment
0001 CTGCTCCTAG CAGGCATCAA TCAAATAGCC GCCGATGACG AGGCCGCCAC AACGGAGACC 
0061 ATCGACCTTG ATCTGGGCTC CTTCAAGGAG GGCTCCCGCA CCGATGCCGA GACCCTGAAG 
0121 CGCGAGGAGG AGGCCATCCA GCTGGACGGC CTGAACGTGG CGCAGCTGAA GGAAATTCGC 
0181 GAGAAGGCGA AGAAGTTTAC TTTCCAAACG GAGGTCAACC GCATGATGAA GCTGATTATC 
0241 AACTCGCTTT ACCGCAACAA GGAGATCTTC CTGCGTGAAT TGATATCCAA CGCCTCCGAT 
0301 GCCATCGACA AGATCCGCCT ATTGGCTCTG TCCAACAGCA AGGAGCTGGA AACGAATCCG 
0361 GAGCTGCACA TCCGCATTAA GGCCGACAAG GAGAACAAGG CGTTGCACAT CATGGACTC- 
0421 GGGTATCGGC ATGACTCACC AGGATCTGAT CAATAACCTG GGTACAATTG CCAAGTCCGG 
0481 CACTGCCGA- TTTTCTGGCC AA 
 Assemble Data

5520R-3.IR_full       1   CTGCTCCTAGCAGGCATCAATCAAATAGCCGCCGATGACGAGGCCGCCACAACGGAGACC 60
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
5520R-3.in silico     1   CTGCTCCTAGCAGGCATCAATCAAATAGCCGCCGATGACGAGGCCGCCACAACGGAGACC 60


5520R-3.IR_full       61  ATCGACCTTGATCTGGGCTCCTTCAAGGAGGGCTCCCGCACCGATGCCGAGACCCTGAAG 120
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
5520R-3.in silico     61  ATCGACCTTGATCTGGGCTCCTTCAAGGAGGGCTCCCGCACCGATGCCGAGACCCTGAAG 120


5520R-3.IR_full       121 CGCGAGGAGGAGGCCATCCAGCTGGACGGCCTGAACGTGGCGCAGCTGAAGGAAATTCGC 180
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
5520R-3.in silico     121 CGCGAGGAGGAGGCCATCCAGCTGGACGGCCTGAACGTGGCGCAGCTGAAGGAAATTCGC 180


5520R-3.IR_full       181 GAGAAGGCGAAGAAGTTTACTTTCCAAACGGAGGTCAACCGCATGATGAAGCTGATTATC 240
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
5520R-3.in silico     181 GAGAAGGCGAAGAAGTTTACTTTCCAAACGGAGGTCAACCGCATGATGAAGCTGATTATC 240


5520R-3.IR_full       241 AACTCGCTTTACCGCAACAAGGAGATCTTCCTGCGTGAATTGATATCCAACGCCTCCGAT 300
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
5520R-3.in silico     241 AACTCGCTTTACCGCAACAAGGAGATCTTCCTGCGTGAATTGATATCCAACGCCTCCGAT 300


5520R-3.IR_full       301 GCCATCGACAAGATCCGCCTATTGGCTCTGTCCAACAGCAAGGAGCTGGAAACGAATCCG 360
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
5520R-3.in silico     301 GCCATCGACAAGATCCGCCTATTGGCTCTGTCCAACAGCAAGGAGCTGGAAACGAATCCG 360


5520R-3.IR_full       361 GAGCTGCACATCCGCATTAAGGCCGACAAGGAGAACAAGGCGTTGCACATCATGGACTCG 420
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| 
5520R-3.in silico     361 GAGCTGCACATCCGCATTAAGGCCGACAAGGAGAACAAGGCGTTGCACATCATGGACTC- 420


5520R-3.IR_full       421 GGGTATCGGCATGACTCACCAGGATCTGATCAATAACCTGGGTACAATTGCCAAGTCCGG 480
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
5520R-3.in silico     421 GGGTATCGGCATGACTCACCAGGATCTGATCAATAACCTGGGTACAATTGCCAAGTCCGG 480


5520R-3.IR_full       481 CACTGCCGATTTTTCTGGCCAA 502
                          ||||||||| ||||||||||||
5520R-3.in silico     481 CACTGCCGA-TTTTCTGGCCAA 502

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_143344.2  CG5520-RA (Gp93), mRNA 
0.2   NM_134917.2  CG15406-RA (CG15406), mRNA 
0   NM_170466.1  CG31025-RA, transcript variant A (CG31025), mRNA 
0   NM_170467.1  CG31025-RB, transcript variant B (CG31025), mRNA 
0   NM_164431.1  CG17654-RB, transcript variant B (Eno), mRNA 
0   NM_164434.1  CG17654-RE, transcript variant E (Eno), mRNA 
0   NM_164432.1  CG17654-RC, transcript variant C (Eno), mRNA 
0   NM_164433.1  CG17654-RD, transcript variant D (Eno), mRNA 
0   NM_058073.3  CG17654-RA, transcript variant A (Eno), mRNA 
0   19  41  NM_079175.2  CG1242-RA (Hsp83), mRNA 
0   NM_167635.1  CG7088-RD, transcript variant D (bnb), mRNA 
0   NM_167633.1  CG7088-RA, transcript variant A (bnb), mRNA 
0   NM_078682.2  CG7088-RC, transcript variant C (bnb), mRNA 
0   NM_167634.1  CG7088-RB, transcript variant B (bnb), mRNA 
0   NM_176121.1  CG33183-RC, transcript variant C (Hr46), mRNA 
0   NM_176123.1  CG33183-RA, transcript variant A (Hr46), mRNA 
0   NM_176122.1  CG33183-RB, transcript variant B (Hr46), mRNA 
0   NM_165102.1  CG4170-RD, transcript variant D (vig), mRNA 
0   NM_165101.1  CG4170-RC, transcript variant C (vig), mRNA 
0   NM_078848.2  CG4170-RA, transcript variant A (vig), mRNA 
0   NM_165100.1  CG4170-RB, transcript variant B (vig), mRNA 
0   NM_137143.1  CG12857-RA (CG12857), mRNA 
0   14  NM_167505.1  CG4211-RB, transcript variant B (nonA), mRNA 
0   14  NM_001014747.1  CG4211-RC, transcript variant C (nonA), mRNA 
0   14  NM_078643.2  CG4211-RA, transcript variant A (nonA), mRNA 
0   11  NM_166126.1  CG18255-RC, transcript variant C (Strn-Mlck), mRNA 
0   NM_166429.1  CG9433-RA, transcript variant A (Xpd), mRNA 
0   NM_057830.3  CG9433-RB, transcript variant B (Xpd), mRNA 
0   NM_170641.1  CG32464-RF, transcript variant F (l(3)82Fd), mRNA 
0   NM_001031978.1  CG32464-RM, transcript variant M (l(3)82Fd), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.